HUGE |
Gene/Protein Characteristic Table for KIAA0697 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04107 |
---|---|
Accession No. : | AB014597 |
Description : | ankyrin repeat domain protein 17 isoform b. |
HUGO Gene Name : | ankyrin repeat domain 17 (ANKRD17) |
Clone Name : | hk04486s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hk04486, former representative clones for KIAA0697 with hk04486s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8456 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 993 bp Genome contig ID gi89161207r_74059819 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
CTTAATATTCTGTTTATTAAATAATTCAATGTACTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATTTTATATTGGATGATATTGATTCTTAACATTGGCTTTTCAGTCATCAA
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 r 74159819 74342903 34 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2486 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TGGAGGAAATCACAAGTGGCC | |
: GGTAAAACGGATGATGATGGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: GeneBridge 4 | |
: TGGAGGAAATCACAAGTGGCC | |
: GGTAAAACGGATGATGATGGG | |
: 162 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |