HUGE

Gene/Protein Characteristic Table for KIAA1223

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04113
Accession No. :	AB033049
Description :	Ankyrin repeat domain-containing protein 50.
HUGO Gene Name :	ankyrin repeat domain 50 (ANKRD50)
Clone Name :	pg00513 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced fh03861, former representative clones for KIAA1223 with pg00513. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 6738 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3466 bp

Genome contig ID gi89161207r_125704657
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TTTTCTAAATAAAATTTGTGTGTTTCTTCACTCAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TAAACTTGCGTCACTTCTTCATGACCTCTTTCCCCACCAGAACACAGCAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 r 125804657 125812863 2 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1089 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAX05206	99.9	ankyrin repeat ...	Homo sapiens
CAE45806	99.9	hypothetical pr...	Homo sapiens
Q9ULJ7	99.9	Ankyrin repeat ...	Homo sapiens
NP_065070	99.9	ankyrin repeat ...	Homo sapiens
BAG58158	99.8	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002377	3.9e-16	32.8	KIAA0379
AB051515	1.2e-15	25.0	KIAA1728
AB033076	1.4e-15	34.7	KIAA1250
AB014597	1.4e-14	32.7	KIAA0697
AB046856	4.1e-12	25.6	KIAA1636

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 507 519 PR01415 Ankyrin

IPR002110 717 729 PR01415 Ankyrin

HMMPfam IPR002110 155 172 PF00023 Ankyrin

IPR002110 184 203 PF00023 Ankyrin

IPR002110 204 236 PF00023 Ankyrin

IPR002110 237 269 PF00023 Ankyrin

IPR002110 270 302 PF00023 Ankyrin

IPR002110 303 335 PF00023 Ankyrin

IPR002110 336 368 PF00023 Ankyrin

IPR002110 369 406 PF00023 Ankyrin

IPR002110 407 439 PF00023 Ankyrin

IPR002110 440 472 PF00023 Ankyrin

IPR002110 473 505 PF00023 Ankyrin

IPR002110 506 538 PF00023 Ankyrin

IPR002110 539 571 PF00023 Ankyrin

IPR002110 572 604 PF00023 Ankyrin

IPR002110 605 637 PF00023 Ankyrin

IPR002110 638 670 PF00023 Ankyrin

IPR002110 671 703 PF00023 Ankyrin

IPR002110 704 736 PF00023 Ankyrin

IPR002110 737 763 PF00023 Ankyrin

HMMSmart IPR002110 204 233 SM00248 Ankyrin

IPR002110 237 266 SM00248 Ankyrin

IPR002110 270 299 SM00248 Ankyrin

IPR002110 303 332 SM00248 Ankyrin

IPR002110 336 365 SM00248 Ankyrin

IPR002110 369 403 SM00248 Ankyrin

IPR002110 407 436 SM00248 Ankyrin

IPR002110 440 469 SM00248 Ankyrin

IPR002110 473 502 SM00248 Ankyrin

IPR002110 506 535 SM00248 Ankyrin

IPR002110 539 568 SM00248 Ankyrin

IPR002110 572 601 SM00248 Ankyrin

IPR002110 605 634 SM00248 Ankyrin

IPR002110 638 667 SM00248 Ankyrin

IPR002110 671 700 SM00248 Ankyrin

IPR002110 704 733 SM00248 Ankyrin

IPR002110 737 767 SM00248 Ankyrin

ProfileScan IPR002110 155 763 PS50297 Ankyrin

IPR002110 204 236 PS50088 Ankyrin

IPR002110 237 269 PS50088 Ankyrin

IPR002110 270 302 PS50088 Ankyrin

IPR002110 303 335 PS50088 Ankyrin

IPR002110 336 368 PS50088 Ankyrin

IPR002110 369 406 PS50088 Ankyrin

IPR002110 407 439 PS50088 Ankyrin

IPR002110 440 472 PS50088 Ankyrin

IPR002110 473 505 PS50088 Ankyrin

IPR002110 506 538 PS50088 Ankyrin

IPR002110 539 571 PS50088 Ankyrin

IPR002110 572 604 PS50088 Ankyrin

IPR002110 605 637 PS50088 Ankyrin

IPR002110 638 670 PS50088 Ankyrin

IPR002110 671 703 PS50088 Ankyrin

IPR002110 704 736 PS50088 Ankyrin

IPR002110 737 763 PS50088 Ankyrin

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	507	519	PR01415	Ankyrin
IPR002110	717	729	PR01415	Ankyrin
HMMPfam	IPR002110	155	172	PF00023	Ankyrin
IPR002110	184	203	PF00023	Ankyrin
IPR002110	204	236	PF00023	Ankyrin
IPR002110	237	269	PF00023	Ankyrin
IPR002110	270	302	PF00023	Ankyrin
IPR002110	303	335	PF00023	Ankyrin
IPR002110	336	368	PF00023	Ankyrin
IPR002110	369	406	PF00023	Ankyrin
IPR002110	407	439	PF00023	Ankyrin
IPR002110	440	472	PF00023	Ankyrin
IPR002110	473	505	PF00023	Ankyrin
IPR002110	506	538	PF00023	Ankyrin
IPR002110	539	571	PF00023	Ankyrin
IPR002110	572	604	PF00023	Ankyrin
IPR002110	605	637	PF00023	Ankyrin
IPR002110	638	670	PF00023	Ankyrin
IPR002110	671	703	PF00023	Ankyrin
IPR002110	704	736	PF00023	Ankyrin
IPR002110	737	763	PF00023	Ankyrin
HMMSmart	IPR002110	204	233	SM00248	Ankyrin
IPR002110	237	266	SM00248	Ankyrin
IPR002110	270	299	SM00248	Ankyrin
IPR002110	303	332	SM00248	Ankyrin
IPR002110	336	365	SM00248	Ankyrin
IPR002110	369	403	SM00248	Ankyrin
IPR002110	407	436	SM00248	Ankyrin
IPR002110	440	469	SM00248	Ankyrin
IPR002110	473	502	SM00248	Ankyrin
IPR002110	506	535	SM00248	Ankyrin
IPR002110	539	568	SM00248	Ankyrin
IPR002110	572	601	SM00248	Ankyrin
IPR002110	605	634	SM00248	Ankyrin
IPR002110	638	667	SM00248	Ankyrin
IPR002110	671	700	SM00248	Ankyrin
IPR002110	704	733	SM00248	Ankyrin
IPR002110	737	767	SM00248	Ankyrin
ProfileScan	IPR002110	155	763	PS50297	Ankyrin
IPR002110	204	236	PS50088	Ankyrin
IPR002110	237	269	PS50088	Ankyrin
IPR002110	270	302	PS50088	Ankyrin
IPR002110	303	335	PS50088	Ankyrin
IPR002110	336	368	PS50088	Ankyrin
IPR002110	369	406	PS50088	Ankyrin
IPR002110	407	439	PS50088	Ankyrin
IPR002110	440	472	PS50088	Ankyrin
IPR002110	473	505	PS50088	Ankyrin
IPR002110	506	538	PS50088	Ankyrin
IPR002110	539	571	PS50088	Ankyrin
IPR002110	572	604	PS50088	Ankyrin
IPR002110	605	637	PS50088	Ankyrin
IPR002110	638	670	PS50088	Ankyrin
IPR002110	671	703	PS50088	Ankyrin
IPR002110	704	736	PS50088	Ankyrin
IPR002110	737	763	PS50088	Ankyrin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: CAAAAGTAAGTATTCCTCGGG

Primer_r
: ATAAGCAAGGCAGGGCATCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CAAAAGTAAGTATTCCTCGGG
Primer_r	: ATAAGCAAGGCAGGGCATCTC
PCR product length	: 120 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3466 bp
Genome contig ID	gi89161207r_125704657
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TTTTCTAAATAAAATTTGTGTGTTTCTTCACTCAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TAAACTTGCGTCACTTCTTCATGACCTCTTTCCCCACCAGAACACAGCAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	r	125804657	125812863	2	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA1223

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information