HUGE |
Gene/Protein Characteristic Table for KIAA1223 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04113 |
---|---|
Accession No. : | AB033049 |
Description : | Ankyrin repeat domain-containing protein 50. |
HUGO Gene Name : | ankyrin repeat domain 50 (ANKRD50) |
Clone Name : | pg00513 [Vector Info] |
Source : | Human brain (hippocampus) |
Note : | We replaced fh03861, former representative clones for KIAA1223 with pg00513. (2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6738 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3466 bp Genome contig ID gi89161207r_125704657 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
TTTTCTAAATAAAATTTGTGTGTTTCTTCACTCAGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
TAAACTTGCGTCACTTCTTCATGACCTCTTTCCCCACCAGAACACAGCAT
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 r 125804657 125812863 2 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1089 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAAAAGTAAGTATTCCTCGGG | |
: ATAAGCAAGGCAGGGCATCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 4 |
: GeneBridge 4 | |
: CAAAAGTAAGTATTCCTCGGG | |
: ATAAGCAAGGCAGGGCATCTC | |
: 120 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |