HUGE |
Gene/Protein Characteristic Table for KIAA0379 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00521 |
---|---|
Accession No. : | AB002377 |
Description : | Ankyrin repeat domain-containing protein 28. |
HUGO Gene Name : | ankyrin repeat domain 28 (ANKRD28) |
Clone Name : | hh00505s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0379 |
Source : | Human adult brain |
Note : | We replaced hh00505, former representative clones for KIAA0379 with hh00505s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4408 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1227 bp Genome contig ID gi89161205r_15583750 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
GACCTTTTAAAAGAAATAAAGTTTTTTAATGCAATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAATCAAGTGTCTGTCTCTTTTACATGCAAACTTCTTTTCCCTTAAACTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 15683750 15875933 29 99.8 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1059 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CCCCAAAATTTACAGCTACAC | |
: GCTCTAGAACTACTTTGGGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: CCCCAAAATTTACAGCTACAC | |
: GCTCTAGAACTACTTTGGGTG | |
: 121 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |