HUGE |
Gene/Protein Characteristic Table for KIAA0229 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01060 |
---|---|
Accession No. : | D86982 |
Description : | Ankyrin repeat and SAM domain-containing protein 1A. |
HUGO Gene Name : | t-complex 11 homolog (mouse) (TCP11) |
Clone Name : | ha02570 [Vector Info] |
Flexi ORF Clone : | pF1KA0229
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6335 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2791 bp Genome contig ID gi89161210f_34865019 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
AGAACAGACTGAATTAATAAATGAGAAGCGACATGFlanking genome sequence
(302138 - 302187) ----+----*----+----*----+----*----+----*----+----*
AACGCAGCCTTAATTCTTCTGAGTCTTTGAATTGGAAAGCGTCTTGATGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 34965019 35167155 24 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1180 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR002110 | 126 | 138 | PR01415 | Ankyrin |
IPR002110 | 138 | 150 | PR01415 | Ankyrin | |
HMMPfam | IPR002110 | 53 | 124 | PF00023 | Ankyrin |
IPR002110 | 125 | 157 | PF00023 | Ankyrin | |
IPR002110 | 158 | 190 | PF00023 | Ankyrin | |
IPR002110 | 194 | 226 | PF00023 | Ankyrin | |
IPR002110 | 227 | 259 | PF00023 | Ankyrin | |
IPR002110 | 260 | 292 | PF00023 | Ankyrin | |
IPR002110 | 295 | 324 | PF00023 | Ankyrin | |
IPR001660 | 740 | 806 | PF00536 | Sterile alpha motif SAM | |
IPR001660 | 814 | 879 | PF00536 | Sterile alpha motif SAM | |
IPR002110 | 895 | 910 | PF00023 | Ankyrin | |
IPR006020 | 988 | 1114 | PF00640 | Phosphotyrosine interaction region | |
HMMSmart | IPR002110 | 125 | 154 | SM00248 | Ankyrin |
IPR002110 | 158 | 187 | SM00248 | Ankyrin | |
IPR002110 | 194 | 223 | SM00248 | Ankyrin | |
IPR002110 | 227 | 256 | SM00248 | Ankyrin | |
IPR002110 | 260 | 289 | SM00248 | Ankyrin | |
IPR002110 | 292 | 321 | SM00248 | Ankyrin | |
IPR001660 | 739 | 808 | SM00454 | Sterile alpha motif SAM | |
IPR001660 | 813 | 881 | SM00454 | Sterile alpha motif SAM | |
IPR006020 | 983 | 1117 | SM00462 | Phosphotyrosine interaction region | |
ProfileScan | IPR002110 | 115 | 330 | PS50297 | Ankyrin |
IPR002110 | 125 | 157 | PS50088 | Ankyrin | |
IPR002110 | 158 | 190 | PS50088 | Ankyrin | |
IPR002110 | 194 | 226 | PS50088 | Ankyrin | |
IPR002110 | 227 | 259 | PS50088 | Ankyrin | |
IPR002110 | 260 | 292 | PS50088 | Ankyrin | |
IPR002110 | 292 | 324 | PS50088 | Ankyrin | |
IPR001660 | 745 | 808 | PS50105 | Sterile alpha motif SAM | |
IPR001660 | 816 | 875 | PS50105 | Sterile alpha motif SAM | |
IPR006020 | 988 | 1114 | PS01179 | Phosphotyrosine interaction region |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 6 |
: Genebridge 4 | |
: GTGCAACAACATAGACTGACC | |
: TTCAGTCTGTTCTAAGTTGTG | |
: 109 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |