HUGE |
Gene/Protein Characteristic Table for KIAA0229 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01060 |
---|---|
Accession No. : | D86982 |
Description : | Ankyrin repeat and SAM domain-containing protein 1A. |
HUGO Gene Name : | t-complex 11 homolog (mouse) (TCP11) |
Clone Name : | ha02570 [Vector Info] |
Flexi ORF Clone : | pF1KA0229
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6335 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2791 bp Genome contig ID gi89161210f_34865019 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
AGAACAGACTGAATTAATAAATGAGAAGCGACATGFlanking genome sequence
(302138 - 302187) ----+----*----+----*----+----*----+----*----+----*
AACGCAGCCTTAATTCTTCTGAGTCTTTGAATTGGAAAGCGTCTTGATGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 f 34965019 35167155 24 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1180 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 6 |
: Genebridge 4 | |
: GTGCAACAACATAGACTGACC | |
: TTCAGTCTGTTCTAAGTTGTG | |
: 109 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |