HUGE

Gene/Protein Characteristic Table for KIAA1636

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK07058
Accession No. :	AB046856
Description :	Putative ankyrin-repeat containing protein.
HUGO Gene Name :
Clone Name :	ff02660 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fh23458, former representative clones for KIAA1636 with ff02660. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 11341 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5744 bp

Genome contig ID gi51511734f_58531880
PolyA signal sequence
(TATAAA,-20)
+----*----+----*----+----*----+----
GCAAATGTACTTATTTATAAATGGCTAACACTTGG
Flanking genome sequence
(326914 - 326963)
----+----*----+----*----+----*----+----*----+----*
AAAACCATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 58631880 58858792 21 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 1864 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9HCD6	100.0	Protein TANC2; ...	Homo sapiens
XP_001116098	99.6	similar to TPR ...	Macaca mulatta
XP_511597	99.6	tetratricopepti...	Pan troglodytes
XP_001501350	98.7	tetratricopepti...	Equus caballus
XP_850197	98.6	similar to TPR ...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB051515	6.2e-127	52.4	KIAA1728
AB032974	1e-83	100.0	KIAA1148
AB033049	6.8e-08	25.7	KIAA1223
AB033076	0.00024	29.7	KIAA1250
AB014597	0.00042	32.0	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 974 986 PR01415 Ankyrin

IPR002110 1019 1031 PR01415 Ankyrin

HMMPfam IPR002110 726 755 PF00023 Ankyrin

IPR002110 767 790 PF00023 Ankyrin

IPR002110 791 823 PF00023 Ankyrin

IPR002110 824 847 PF00023 Ankyrin

IPR002110 868 886 PF00023 Ankyrin

IPR002110 907 939 PF00023 Ankyrin

IPR002110 940 972 PF00023 Ankyrin

IPR002110 973 1005 PF00023 Ankyrin

IPR002110 1006 1038 PF00023 Ankyrin

IPR002110 1039 1071 PF00023 Ankyrin

IPR002110 1072 1104 PF00023 Ankyrin

IPR001440 1165 1198 PF00515 Tetratricopeptide TPR_1

IPR001440 1199 1232 PF00515 Tetratricopeptide TPR_1

HMMSmart IPR002110 720 752 SM00248 Ankyrin

IPR002110 756 787 SM00248 Ankyrin

IPR002110 791 820 SM00248 Ankyrin

IPR002110 824 853 SM00248 Ankyrin

IPR002110 864 892 SM00248 Ankyrin

IPR002110 907 936 SM00248 Ankyrin

IPR002110 940 969 SM00248 Ankyrin

IPR002110 973 1002 SM00248 Ankyrin

IPR002110 1006 1035 SM00248 Ankyrin

IPR002110 1039 1068 SM00248 Ankyrin

IPR002110 1072 1101 SM00248 Ankyrin

IPR013026 1118 1151 SM00028 Tetratricopeptide region

IPR013026 1165 1198 SM00028 Tetratricopeptide region

IPR013026 1199 1232 SM00028 Tetratricopeptide region

ProfileScan IPR002110 736 1099 PS50297 Ankyrin

IPR002110 791 823 PS50088 Ankyrin

IPR002110 907 939 PS50088 Ankyrin

IPR002110 940 972 PS50088 Ankyrin

IPR002110 973 1005 PS50088 Ankyrin

IPR002110 1006 1038 PS50088 Ankyrin

IPR002110 1039 1071 PS50088 Ankyrin

IPR013026 1118 1151 PS50005 Tetratricopeptide region

IPR013026 1118 1232 PS50293 Tetratricopeptide region

IPR013026 1165 1198 PS50005 Tetratricopeptide region

IPR013026 1199 1232 PS50005 Tetratricopeptide region

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	974	986	PR01415	Ankyrin
IPR002110	1019	1031	PR01415	Ankyrin
HMMPfam	IPR002110	726	755	PF00023	Ankyrin
IPR002110	767	790	PF00023	Ankyrin
IPR002110	791	823	PF00023	Ankyrin
IPR002110	824	847	PF00023	Ankyrin
IPR002110	868	886	PF00023	Ankyrin
IPR002110	907	939	PF00023	Ankyrin
IPR002110	940	972	PF00023	Ankyrin
IPR002110	973	1005	PF00023	Ankyrin
IPR002110	1006	1038	PF00023	Ankyrin
IPR002110	1039	1071	PF00023	Ankyrin
IPR002110	1072	1104	PF00023	Ankyrin
IPR001440	1165	1198	PF00515	Tetratricopeptide TPR_1
IPR001440	1199	1232	PF00515	Tetratricopeptide TPR_1
HMMSmart	IPR002110	720	752	SM00248	Ankyrin
IPR002110	756	787	SM00248	Ankyrin
IPR002110	791	820	SM00248	Ankyrin
IPR002110	824	853	SM00248	Ankyrin
IPR002110	864	892	SM00248	Ankyrin
IPR002110	907	936	SM00248	Ankyrin
IPR002110	940	969	SM00248	Ankyrin
IPR002110	973	1002	SM00248	Ankyrin
IPR002110	1006	1035	SM00248	Ankyrin
IPR002110	1039	1068	SM00248	Ankyrin
IPR002110	1072	1101	SM00248	Ankyrin
IPR013026	1118	1151	SM00028	Tetratricopeptide region
IPR013026	1165	1198	SM00028	Tetratricopeptide region
IPR013026	1199	1232	SM00028	Tetratricopeptide region
ProfileScan	IPR002110	736	1099	PS50297	Ankyrin
IPR002110	791	823	PS50088	Ankyrin
IPR002110	907	939	PS50088	Ankyrin
IPR002110	940	972	PS50088	Ankyrin
IPR002110	973	1005	PS50088	Ankyrin
IPR002110	1006	1038	PS50088	Ankyrin
IPR002110	1039	1071	PS50088	Ankyrin
IPR013026	1118	1151	PS50005	Tetratricopeptide region
IPR013026	1118	1232	PS50293	Tetratricopeptide region
IPR013026	1165	1198	PS50005	Tetratricopeptide region
IPR013026	1199	1232	PS50005	Tetratricopeptide region

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: genbank
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5744 bp
Genome contig ID	gi51511734f_58531880
PolyA signal sequence (TATAAA,-20)	+--------+--------+----*----+---- GCAAATGTACTTATTTATAAATGGCTAACACTTGG
Flanking genome sequence (326914 - 326963)	----+--------+--------+--------+--------+----* AAAACCATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	58631880	58858792	21	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1636

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information