HUGE |
Gene/Protein Characteristic Table for KIAA1636 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK07058 |
---|---|
Accession No. : | AB046856 |
Description : | Putative ankyrin-repeat containing protein. |
HUGO Gene Name : | |
Clone Name : | ff02660 [Vector Info] |
Source : | Human fetal brain |
Note : | We replaced fh23458, former representative clones for KIAA1636 with ff02660. (2003/4/2) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 11341 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5744 bp Genome contig ID gi51511734f_58531880 PolyA signal sequence
(TATAAA,-20) +----*----+----*----+----*----+----
GCAAATGTACTTATTTATAAATGGCTAACACTTGGFlanking genome sequence
(326914 - 326963) ----+----*----+----*----+----*----+----*----+----*
AAAACCATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 58631880 58858792 21 99.3 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1864 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
RH mapping information |
Description | |
---|---|---|
: 17 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |