HUGE

Gene/Protein Characteristic Table for KIAA1148

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05638
Accession No. :	AB032974
Description :	Putative ankyrin-repeat containing protein.
HUGO Gene Name :	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 (TANC2)
Clone Name :	bg00390 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00436, former representative clones for KIAA1148 with bg00390. (2002/12/27) Please refer to "Gene/Protein Characteristic Table for KIAA1636" because the cDNA sequence of KIAA1148 is included in KIAA1636.

Features of the cloned DNA sequence	Description

Length: 7384 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 5750 bp

Genome contig ID gi51511734f_58751415
PolyA signal sequence
(TATAAA,-26)
+----*----+----*----+----*----+----
GTACTTATTTATAAATGGCTAACACTTGGAAAACC
Flanking genome sequence
(107385 - 107434)
----+----*----+----*----+----*----+----*----+----*
ATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGGGAGCTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 f 58851415 58858798 1 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 543 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAB92314	1e-164	100.0	putative ankyri...	Homo sapiens
EAW94330	1.3e-164	100.0	hCG1810810, iso...	Homo sapiens
EAW94331	1.4e-164	100.0	hCG1810810, iso...	Homo sapiens
EAW94329	1.5e-164	100.0	hCG1810810, iso...	Homo sapiens
EAW94327	1.5e-164	100.0	hCG1810810, iso...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046856	1.1e-86	100.0	KIAA1636

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ATCTCCACTTCATTCACAGGT

Primer_r
: CAAAGATGCTGTGCTAGATGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	5750 bp
Genome contig ID	gi51511734f_58751415
PolyA signal sequence (TATAAA,-26)	+--------+--------+----*----+---- GTACTTATTTATAAATGGCTAACACTTGGAAAACC
Flanking genome sequence (107385 - 107434)	----+--------+--------+--------+--------+----* ATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGGGAGCTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	f	58851415	58858798	1	100.0	Perfect prediction

Primer_f	: ATCTCCACTTCATTCACAGGT
Primer_r	: CAAAGATGCTGTGCTAGATGG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1148

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information