HUGE |
Gene/Protein Characteristic Table for KIAA1148 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05638 |
---|---|
Accession No. : | AB032974 |
Description : | Putative ankyrin-repeat containing protein. |
HUGO Gene Name : | tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2 (TANC2) |
Clone Name : | bg00390 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hg00436, former representative clones for KIAA1148 with bg00390. (2002/12/27) Please refer to "Gene/Protein Characteristic Table for KIAA1636" because the cDNA sequence of KIAA1148 is included in KIAA1636. |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7384 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 5750 bp Genome contig ID gi51511734f_58751415 PolyA signal sequence
(TATAAA,-26) +----*----+----*----+----*----+----
GTACTTATTTATAAATGGCTAACACTTGGAAAACCFlanking genome sequence
(107385 - 107434) ----+----*----+----*----+----*----+----*----+----*
ATGGTGTTGTGATGCTTTTCTCCTTCCATTACAGCCTCTTCAGGGAGCTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 58851415 58858798 1 100.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 543 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: ATCTCCACTTCATTCACAGGT | |
: CAAAGATGCTGTGCTAGATGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: unigene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |