HUGE |
Gene/Protein Characteristic Table for KIAA0396 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01595 |
---|---|
Accession No. : | AB007856 |
Description : | fem-1 homolog b. |
HUGO Gene Name : | |
Clone Name : | hg00180s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0396
![]() |
Source : | Human adult brain |
Note : | We replaced hg00180, former representative clones for KIAA0396 with hg00180s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6497 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4613 bp Genome contig ID gi51511731f_66257810 PolyA signal sequence
(AGTAAA,-12) +----*----+----*----+----*----+----
AGGAAAAAATGGTGTTTGTGTTCAGTAAATGTTTGFlanking genome sequence
(117439 - 117488) ----+----*----+----*----+----*----+----*----+----*
AAAAAAACTACTTTGAGGTTTGTGTCTTTATTAATTATTCAGTGTGCCTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 66357810 66375247 2 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 627 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AAATCACTAATGGACCTCTGG | |
: CGGTGATGTCATTCTATTGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: GeneBridge 4 | |
: AAATCACTAATGGACCTCTGG | |
: CGGTGATGTCATTCTATTGTG | |
: 99 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |