HUGE

Gene/Protein Characteristic Table for KIAA1876

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04860
Accession No. :	AB058779
Description :	Histone-lysine N-methyltransferase, H3 lysine-9 specific 5.
HUGO Gene Name :	euchromatic histone-lysine N-methyltransferase 1 (EHMT1)
Clone Name :	pf01162s1 [Vector Info]
Source :	Human brain (hippocampus)
Note :	We replaced pf01162, former representative clones for KIAA1876 with pf01162s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 7842 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 5430 bp

Genome contig ID gi89161216f_139666602
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
CACTTCAGCCTGGGCAACAGATCGAGATTTCGTCT
Flanking genome sequence
(217689 - 217738)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAGAACATAACAGGCCGAGTGTGGTGGCTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 f 139758337 139884289 22 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 803 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAB56104	100.0	GLP1 [Homo sapi...	Homo sapiens
Q9H9B1	100.0	Histone-lysine ...	Homo sapiens
AAM09024	99.9	euchromatic his...	Homo sapiens
XP_520395	99.8	euchromatic his...	Pan troglodytes
XP_848228	92.0	similar to euch...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023174	9.1e-14	30.1	KIAA0957
AB033049	4.4e-13	35.1	KIAA1223
AB033076	1.8e-09	31.5	KIAA1250
AB002377	2.5e-09	33.1	KIAA0379
AB014597	1.2e-07	28.7	KIAA0697

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 458 470 PR01415 Ankyrin

IPR002110 504 516 PR01415 Ankyrin

HMMPfam IPR002110 391 423 PF00023 Ankyrin

IPR002110 424 456 PF00023 Ankyrin

IPR002110 457 490 PF00023 Ankyrin

IPR002110 491 523 PF00023 Ankyrin

IPR002110 524 556 PF00023 Ankyrin

IPR002110 557 589 PF00023 Ankyrin

IPR002110 590 601 PF00023 Ankyrin

IPR007728 632 737 PF05033 Pre-SET zinc-binding region

IPR001214 739 798 PF00856 SET

HMMSmart IPR002110 391 420 SM00248 Ankyrin

IPR002110 424 455 SM00248 Ankyrin

IPR002110 457 487 SM00248 Ankyrin

IPR002110 491 520 SM00248 Ankyrin

IPR002110 524 553 SM00248 Ankyrin

IPR002110 557 586 SM00248 Ankyrin

IPR002110 590 623 SM00248 Ankyrin

IPR003606 630 729 SM00468 Pre-SET zinc-binding sub-group

ProfileScan IPR002110 361 598 PS50297 Ankyrin

IPR002110 391 423 PS50088 Ankyrin

IPR002110 424 456 PS50088 Ankyrin

IPR002110 457 481 PS50088 Ankyrin

IPR002110 491 523 PS50088 Ankyrin

IPR002110 557 589 PS50088 Ankyrin

IPR007728 679 742 PS50867 Pre-SET zinc-binding region

IPR001214 744 803 PS50280 SET

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	458	470	PR01415	Ankyrin
IPR002110	504	516	PR01415	Ankyrin
HMMPfam	IPR002110	391	423	PF00023	Ankyrin
IPR002110	424	456	PF00023	Ankyrin
IPR002110	457	490	PF00023	Ankyrin
IPR002110	491	523	PF00023	Ankyrin
IPR002110	524	556	PF00023	Ankyrin
IPR002110	557	589	PF00023	Ankyrin
IPR002110	590	601	PF00023	Ankyrin
IPR007728	632	737	PF05033	Pre-SET zinc-binding region
IPR001214	739	798	PF00856	SET
HMMSmart	IPR002110	391	420	SM00248	Ankyrin
IPR002110	424	455	SM00248	Ankyrin
IPR002110	457	487	SM00248	Ankyrin
IPR002110	491	520	SM00248	Ankyrin
IPR002110	524	553	SM00248	Ankyrin
IPR002110	557	586	SM00248	Ankyrin
IPR002110	590	623	SM00248	Ankyrin
IPR003606	630	729	SM00468	Pre-SET zinc-binding sub-group
ProfileScan	IPR002110	361	598	PS50297	Ankyrin
IPR002110	391	423	PS50088	Ankyrin
IPR002110	424	456	PS50088	Ankyrin
IPR002110	457	481	PS50088	Ankyrin
IPR002110	491	523	PS50088	Ankyrin
IPR002110	557	589	PS50088	Ankyrin
IPR007728	679	742	PS50867	Pre-SET zinc-binding region
IPR001214	744	803	PS50280	SET

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGACAGGTGATTCCGTAAC

Primer_r
: GGGTCAGCTCTGCAAAGGTAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: CCR
Primer_f	: TGAGACAGGTGATTCCGTAAC
Primer_r	: GGGTCAGCTCTGCAAAGGTAG
PCR product length	: 95 bp
PCR conditions	: 15 °C64 sec60 °C30 sec175 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	5430 bp
Genome contig ID	gi89161216f_139666602
PolyA signal sequence (None)	+--------+--------+----*----+---- CACTTCAGCCTGGGCAACAGATCGAGATTTCGTCT
Flanking genome sequence (217689 - 217738)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAGAACATAACAGGCCGAGTGTGGTGGCTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	f	139758337	139884289	22	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA1876

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information