HUGE

Gene/Protein Characteristic Table for KIAA0664

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK05614
Accession No. :	AB014564
Description :	Putative eukaryotic translation initiation factor 3 subunit.
HUGO Gene Name :
Clone Name :	hk02041 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4611 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Features of the protein sequence	Description

Length: 1134 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH10532	99.8	hypothetical pr...	Homo sapiens
XP_001504428	95.9	similar to Puta...	Equus caballus
XP_548323	95.4	similar to Puta...	Canis lupus fam...
XP_888319	95.2	similar to Puta...	Bos taurus
XP_854494	95.3	similar to Puta...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB082531	1.4e-07	23.8	KIAA2000

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

ScanRegExp IPR002086 657 664 PS00687 Aldehyde dehydrogenase

Search method	interpro_ID	From	To	Entry	Definition
ScanRegExp	IPR002086	657	664	PS00687	Aldehyde dehydrogenase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GAATGTATCCCTCCCCTCAGT

Primer_r
: TCACGTCGGCACCTGTAACTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAATGTATCCCTCCCCTCAGT
Primer_r	: TCACGTCGGCACCTGTAACTC
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Gene/Protein Characteristic Table for KIAA0664

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information