HUGE |
Gene/Protein Characteristic Table for KIAA0242 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | D87684 |
Description : | UBX domain-containing protein 2. |
HUGO Gene Name : | UBX domain protein 4 (UBXN4) |
Clone Name : | ha03111 [Vector Info] |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3666 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: YES | YES | Warning for coding interruption: YES | NO | |
Length of 3'UTR 2169 bp Genome contig ID gi89161199f_136115906 PolyA signal sequence
(AATAAA,-20) +----*----+----*----+----*----+----
AATCTTTATTTTTTAAATAAATGGGATCATATTATFlanking genome sequence
(143191 - 143240) ----+----*----+----*----+----*----+----*----+----*
ATATTCTACCTTGCATCTTGCTTTTTTGCTTACATAGTCTTGAGATCTTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 2 f 136215906 136259095 13 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 529 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 2 |
: Genebridge 4 | |
: TCGTAATTTTGGTAGTAGGAGG | |
: CTCTGGAGAATAGTACTGGGG | |
: 144 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |