HUGE

Gene/Protein Characteristic Table for KIAA0242

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	D87684
Description :	UBX domain-containing protein 2.
HUGO Gene Name :	UBX domain protein 4 (UBXN4)
Clone Name :	ha03111 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 3666 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 2169 bp

Genome contig ID gi89161199f_136115906
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AATCTTTATTTTTTAAATAAATGGGATCATATTAT
Flanking genome sequence
(143191 - 143240)
----+----*----+----*----+----*----+----*----+----*
ATATTCTACCTTGCATCTTGCTTTTTTGCTTACATAGTCTTGAGATCTTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 136215906 136259095 13 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 529 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q92575	5.5e-162	100.0	UBX domain-cont...	Homo sapiens
Q5R4I3	9e-162	99.8	UBX domain-cont...	Pongo abelii
XP_515808	5.5e-153	93.4	UBX domain cont...	Pan troglodytes
XP_001489608	9.1e-150	92.7	similar to UBX ...	Equus caballus
Q3ZBU9	4.9e-149	91.9	UBX domain-cont...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001012 335 416 PF00789 UBX

HMMSmart IPR001012 332 416 SM00166 UBX

ProfileScan IPR001012 336 414 PS50033 UBX

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001012	335	416	PF00789	UBX
HMMSmart	IPR001012	332	416	SM00166	UBX
ProfileScan	IPR001012	336	414	PS50033	UBX

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TCGTAATTTTGGTAGTAGGAGG
Primer_r	: CTCTGGAGAATAGTACTGGGG
PCR product length	: 144 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	2169 bp
Genome contig ID	gi89161199f_136115906
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AATCTTTATTTTTTAAATAAATGGGATCATATTAT
Flanking genome sequence (143191 - 143240)	----+--------+--------+--------+--------+----* ATATTCTACCTTGCATCTTGCTTTTTTGCTTACATAGTCTTGAGATCTTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	136215906	136259095	13	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0242

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information