HUGE

Gene/Protein Characteristic Table for KIAA0243

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK07224
Accession No. :	D87683
Description :	Hamartin.
HUGO Gene Name :	tuberous sclerosis 1 (TSC1)
Clone Name :	ha04782 [Vector Info]
Source :	Myeloblast cell line (KG-1)

Features of the cloned DNA sequence	Description

Length: 6984 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 4884 bp

Genome contig ID gi89161216r_134656558
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
AACTGTGAACAAATAAAAATTTATTGTTTTGCACT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTCTGCTGTGTGGACATGGAGTGGCTTACACTGGCCTTGGCAGGCTTAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 134756558 134771981 10 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 699 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAH13883	0	100.0	unnamed protein...	Homo sapiens
Q92574	0	100.0	Hamartin; Tuber...	Homo sapiens
XP_520334	0	99.9	tuberous sclero...	Pan troglodytes
CAH89743	0	98.7	hypothetical pr...	Pongo abelii
XP_001168941	3.7e-216	99.9	tuberous sclero...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007483 1 254 PF04388 Hamartin

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007483	1	254	PF04388	Hamartin

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TAAACTTTCCCGCCTCAATCC
Primer_r	: CCCATTCACTAAGATTGTACC
PCR product length	: 99 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	4884 bp
Genome contig ID	gi89161216r_134656558
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- AACTGTGAACAAATAAAAATTTATTGTTTTGCACT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTCTGCTGTGTGGACATGGAGTGGCTTACACTGGCCTTGGCAGGCTTAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	134756558	134771981	10	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0243

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information