HUGE |
Gene/Protein Characteristic Table for KIAA0245 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00475 |
---|---|
Accession No. : | D87432 |
Description : | solute carrier family 7 (cationic amino acid transporter, y+ system), member 6. |
HUGO Gene Name : | solute carrier family 7 (cationic amino acid transporter, y+ system), member 6 (SLC7A6) |
Clone Name : | ha07016 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0245 |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6296 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 4487 bp Genome contig ID gi51511732f_66757995 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
TGTTATCAGACACCAATAAATTCTTTTTGTTGGGCFlanking genome sequence
(135230 - 135279) ----+----*----+----*----+----*----+----*----+----*
CTTCTTCTCTCTTCTTTAATATAGTTACTACGGGAATTATGTTGTCAGAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 66857995 66893223 11 99.3 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 552 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 16 |
: Genebridge 4 | |
: CCTTCACACTGGAGTATTTTG | |
: TTGCATATTCTTTTGGGGAGG | |
: 170 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |