HUGE |
Gene/Protein Characteristic Table for KIAA0250 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00477 |
---|---|
Accession No. : | D87437 |
Description : | Protein SMG7. |
HUGO Gene Name : | Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG7) |
Clone Name : | ha02790 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0250
![]() |
Source : | Myeloblast cell line (KG-1) |
Note : | We replaced ha02794, former representative clones for KIAA0250 with ha02790. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5623 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2253 bp Genome contig ID gi89161185f_181608285 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
GCTTTGCCTTTAATTAAACCATGTTCTCTCCAACCFlanking genome sequence
(181665 - 181714) ----+----*----+----*----+----*----+----*----+----*
AGATCTGTGTATCGATTCTTTCTTTTCTATCCTAAAAGATATAAAAGAAG
Chr f/r start end exon identity class ContigView(URL based/DAS) 1 f 181708285 181789948 22 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1122 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 1 |
: Genebridge 4 | |
: CTCCTATCTAAAGCCCCATTC | |
: CTGATAAAGATTCTCCTCCCC | |
: 126 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |