HUGE

Gene/Protein Characteristic Table for KIAA0250

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00477
Accession No. :	D87437
Description :	Protein SMG7.
HUGO Gene Name :	Smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG7)
Clone Name :	ha02790 [Vector Info]
Flexi ORF Clone :	pF1KSDA0250
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha02794, former representative clones for KIAA0250 with ha02790. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5623 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2253 bp

Genome contig ID gi89161185f_181608285
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
GCTTTGCCTTTAATTAAACCATGTTCTCTCCAACC
Flanking genome sequence
(181665 - 181714)
----+----*----+----*----+----*----+----*----+----*
AGATCTGTGTATCGATTCTTTCTTTTCTATCCTAAAAGATATAAAAGAAG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 f 181708285 181789948 22 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1122 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09675	100.0	Smg-7 homolog, ...	synthetic construct
NP_963862	99.9	SMG-7 homolog i...	Homo sapiens
XP_001489684	97.8	Smg-7 homolog, ...	Equus caballus
XP_877580	96.2	similar to SMG-...	Bos taurus
NP_963863	99.9	SMG-7 homolog i...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB018275	0.00051	24.1	KIAA0732

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CTCCTATCTAAAGCCCCATTC
Primer_r	: CTGATAAAGATTCTCCTCCCC
PCR product length	: 126 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2253 bp
Genome contig ID	gi89161185f_181608285
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- GCTTTGCCTTTAATTAAACCATGTTCTCTCCAACC
Flanking genome sequence (181665 - 181714)	----+--------+--------+--------+--------+----* AGATCTGTGTATCGATTCTTTCTTTTCTATCCTAAAAGATATAAAAGAAG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	f	181708285	181789948	22	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0250

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information