HUGE

Gene/Protein Characteristic Table for KIAA0732

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00120
Accession No. :	AB018275
Description :	Telomerase-binding protein EST1A.
HUGO Gene Name :	Smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans) (SMG6)
Clone Name :	fg05988b [Vector Info]
Flexi ORF Clone :	pF1KA0732
Source :	Human fetal brain
Note :	We replaced hk03717, former representative clones for KIAA0732 with fg05988b. (2001/5/29)

Features of the cloned DNA sequence	Description

Length: 6002 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1650 bp

Genome contig ID gi51511734r_1809888
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
TTTGTTTCCTTAATAAATTTTTAGTTATGAAACAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACCTGACCTCTTGCTGATCTGTTTCTGGGACTGGGGAGGGAGGCAGGTCC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 17 r 1909888 2153826 19 99.4 Terminal No-hit

Features of the protein sequence	Description

Length: 1449 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW90558	99.9	hCG1813980, iso...	Homo sapiens
BAG11233	100.0	Smg-6 homolog, ...	synthetic construct
AAN46114	99.9	telomerase subu...	Homo sapiens
Q86US8	99.9	Telomerase-bind...	Homo sapiens
AAO17581	99.9	Est1p-like prot...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D87437	2.1e-08	24.1	KIAA0250
AB029012	7.2e-05	24.8	KIAA1089

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR006596 1276 1427 SM00670 Nucleotide binding protein

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR006596	1276	1427	SM00670	Nucleotide binding protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TCTTCCCCTTCTAGTTGATCC

Primer_r
: CTGTACTAGGTTCCTGCCATG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	1650 bp
Genome contig ID	gi51511734r_1809888
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- TTTGTTTCCTTAATAAATTTTTAGTTATGAAACAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACCTGACCTCTTGCTGATCTGTTTCTGGGACTGGGGAGGGAGGCAGGTCC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	17	r	1909888	2153826	19	99.4	Terminal No-hit

Primer_f	: TCTTCCCCTTCTAGTTGATCC
Primer_r	: CTGTACTAGGTTCCTGCCATG
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0732

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information