HUGE

Gene/Protein Characteristic Table for KIAA0262

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00482
Accession No. :	D87451
Description :	RING finger protein 10.
HUGO Gene Name :	ring finger protein 10 (RNF10)
Clone Name :	ha07073s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0262
Source :	Myeloblast cell line (KG-1)
Note :	We replaced ha07073, former representative clones for KIAA0262 with ha07073s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 2657 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 221 bp

Genome contig ID gi89161190f_119356998
PolyA signal sequence
(AATAAA,-21)
+----*----+----*----+----*----+----
TGTCTTTACACCAAAATAAAGTATTGACACAAGAG
Flanking genome sequence
(142077 - 142126)
----+----*----+----*----+----*----+----*----+----*
ATCTCTTCCTGCCAAGGTTTTTAGTTCATTGCCAGTTTAGTCTTTTTGAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 f 119456998 119499073 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 811 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAP36359	100.0	ring finger pro...	synthetic construct
AAH31596	99.9	Ring finger pro...	Homo sapiens
BAG53531	99.9	unnamed protein...	Homo sapiens
BAG52797	99.9	unnamed protein...	Homo sapiens
BAG63094	99.9	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001841 225 266 PF00097 Zinc finger

HMMSmart IPR001841 225 266 SM00184 Zinc finger

ProfileScan IPR001841 225 266 PS50089 Zinc finger

ScanRegExp IPR001841 240 249 PS00518 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001841	225	266	PF00097	Zinc finger
HMMSmart	IPR001841	225	266	SM00184	Zinc finger
ProfileScan	IPR001841	225	266	PS50089	Zinc finger
ScanRegExp	IPR001841	240	249	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TTTCCCCCATGCTTTTGTTTG
Primer_r	: ATTTTCTTGGTTCCCCCTCAC
PCR product length	: 108 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	221 bp
Genome contig ID	gi89161190f_119356998
PolyA signal sequence (AATAAA,-21)	+--------+--------+----*----+---- TGTCTTTACACCAAAATAAAGTATTGACACAAGAG
Flanking genome sequence (142077 - 142126)	----+--------+--------+--------+--------+----* ATCTCTTCCTGCCAAGGTTTTTAGTTCATTGCCAGTTTAGTCTTTTTGAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	f	119456998	119499073	17	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0262

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information