HUGE |
Gene/Protein Characteristic Table for KIAA0266 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00042 |
---|---|
Accession No. : | D87455 |
Description : | U3 small nucleolar RNA-associated protein 14 homolog C. |
HUGO Gene Name : | asparagine-linked glycosylation 11, alpha-1,2-mannosyltransferase homolog (yeast) (ALG11) |
Clone Name : | ha02755 [Vector Info] |
Flexi ORF Clone : | pF1KA0266
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5585 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2551 bp Genome contig ID gi51511729f_51396828 PolyA signal sequence
(ATTAAA,-14) +----*----+----*----+----*----+----
ATTCCCAAGCTCCATATGCCAATTAAAGAAGAAACFlanking genome sequence None
Chr f/r start end exon identity class ContigView(URL based/DAS) 13 f 51496828 51515697 4 98.8 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 766 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 13 |
: Genebridge 4 | |
: CAGCAGTGGAGATTTGTATTC | |
: GAGCTTGGGAATATTAGTAGG | |
: 255 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |