HUGE |
Gene/Protein Characteristic Table for KIAA0267 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00043 |
---|---|
Accession No. : | D87743 |
Description : | Sodium/hydrogen exchanger 6. |
HUGO Gene Name : | solute carrier family 9 (sodium/hydrogen exchanger), member 6 (SLC9A6) |
Clone Name : | ha07045 [Vector Info] |
Flexi ORF Clone : | pF1KA0267
![]() |
Source : | Myeloblast cell line (KG-1) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4408 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2407 bp Genome contig ID gi89161218f_134795337 PolyA signal sequence
(ATTAAA,-34) +----*----+----*----+----*----+----
CATTAAAAAAGTTATAGCCTTGCAAATAACCACTCFlanking genome sequence
(161623 - 161672) ----+----*----+----*----+----*----+----*----+----*
ACAGTATTTGAGTCACAGTTTATTTTAGTGAGACGTAAAGAGTGCTGACT
Features of the protein sequence |
Description | |
---|---|---|
Length: 666 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: X |
: Genebridge 4 | |
: CATTTATCCTAGTTGTCCGTG | |
: CCACTATAACATCTGTCCAAG | |
: 108 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |