HUGE

Gene/Protein Characteristic Table for KIAA0269

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00484
Accession No. :	D87459
Description :	Wiskott-Aldrich syndrome protein family member 1.
HUGO Gene Name :	WAS protein family, member 1 (WASF1)
Clone Name :	ha06751 [Vector Info]
Flexi ORF Clone :	pF1KSDA0269
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2625 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 703 bp

Genome contig ID gi89161210r_110427715
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CAGTCTGATTTAATAAATGGTTCATTTTAAAAGTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CATCAGTGTTGCTCTTTGAATAAAATGATTTATCATAATTTATCAAATAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 110527715 110606609 10 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 567 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW48330	2e-136	99.3	WAS protein fam...	Homo sapiens
Q92558	3.6e-136	100.0	Wiskott-Aldrich...	Homo sapiens
Q5NVG8	5.9e-136	99.8	Wiskott-Aldrich...	Pongo abelii
XP_001504068	7.7e-136	99.5	similar to Wisk...	Equus caballus
XP_532260	1.3e-135	99.5	similar to Wisk...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020707	6.2e-19	49.9	KIAA0900

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR003124 505 522 PF02205 Actin-binding WH2

HMMSmart IPR003124 505 522 SM00246 Actin-binding WH2

ProfileScan IPR003124 505 522 PS51082 Actin-binding WH2

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR003124	505	522	PF02205	Actin-binding WH2
HMMSmart	IPR003124	505	522	SM00246	Actin-binding WH2
ProfileScan	IPR003124	505	522	PS51082	Actin-binding WH2

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGAGCCTTATTCCATTTCCTG
Primer_r	: AGGGGATACTGCTAAACATTC
PCR product length	: 182 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	703 bp
Genome contig ID	gi89161210r_110427715
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CAGTCTGATTTAATAAATGGTTCATTTTAAAAGTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CATCAGTGTTGCTCTTTGAATAAAATGATTTATCATAATTTATCAAATAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	110527715	110606609	10	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0269

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information