HUGE |
Gene/Protein Characteristic Table for KIAA0269 |
Link to :
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00484 |
---|---|
Accession No. : | D87459 |
Description : | Wiskott-Aldrich syndrome protein family member 1. |
HUGO Gene Name : | WAS protein family, member 1 (WASF1) |
Clone Name : | ha06751 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0269
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2625 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 703 bp Genome contig ID gi89161210r_110427715 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
CAGTCTGATTTAATAAATGGTTCATTTTAAAAGTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
CATCAGTGTTGCTCTTTGAATAAAATGATTTATCATAATTTATCAAATAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 6 r 110527715 110606609 10 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 567 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 6 |
: Genebridge 4 | |
: TGAGCCTTATTCCATTTCCTG | |
: AGGGGATACTGCTAAACATTC | |
: 182 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |