HUGE |
Gene/Protein Characteristic Table for KIAA0271 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00485 |
---|---|
Accession No. : | D87461 |
Description : | Apoptosis regulator Bcl-W. |
HUGO Gene Name : | BCL2-like 2 (BCL2L2) |
Clone Name : | ha06752 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0271
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3542 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2784 bp Genome contig ID gi51511730f_22745876 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
TAAAAACAATAAATAAAGCCCAGAAGTTTAATGAGFlanking genome sequence
(104924 - 104973) ----+----*----+----*----+----*----+----*----+----*
AAGGACTGAACAGGGTTTGTGACTTCTACACTGTATAGCCTGGGGTCAGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 14 f 22845876 22850798 4 99.0 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 202 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RH mapping information |
Description | |
---|---|---|
: 14 |
: Genebridge 4 | |
: AAGTAGGAGGAGAGGGGTTTC | |
: TGTGTGCCCTAGAATAAGTGG | |
: 141 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |