HUGE

Gene/Protein Characteristic Table for KIAA0272

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00486
Accession No. :	D87462
Description :	Ubiquitin carboxyl-terminal hydrolase BAP1.
HUGO Gene Name :	BRCA1 associated protein-1 (ubiquitin carboxy-terminal hydrolase) (BAP1)
Clone Name :	ha06802s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0272
Source :	Human adult brain
Note :	We replaced ha06802, former representative clones for KIAA0272 with ha06802s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 3589 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1275 bp

Genome contig ID gi89161205r_52310069
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
CAATGAATGAATAAAACTCTCCTAAGAATCTCCTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGAAATGAACCCTCCTGTGGTTGCTGGCCTGAGATATGGAGGCTGGGCCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 3 r 52410069 52419058 17 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 759 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92560	100.0	Ubiquitin carbo...	Homo sapiens
XP_001171970	99.7	BRCA1 associate...	Pan troglodytes
XP_001089173	98.6	similar to BRCA...	Macaca mulatta
XP_541853	96.0	similar to BRCA...	Canis lupus fam...
XP_001493524	95.3	BRCA1 associate...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001578 42 262 PD350662 Peptidase C12

FPrintScan IPR001578 37 54 PR00707 Peptidase C12

IPR001578 115 132 PR00707 Peptidase C12

IPR001578 210 220 PR00707 Peptidase C12

HMMPfam IPR001578 34 246 PF01088 Peptidase C12

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001578	42	262	PD350662	Peptidase C12
FPrintScan	IPR001578	37	54	PR00707	Peptidase C12
IPR001578	115	132	PR00707	Peptidase C12
IPR001578	210	220	PR00707	Peptidase C12
HMMPfam	IPR001578	34	246	PF01088	Peptidase C12

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 3

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: ACAGCAGGATCAAGACAACCC
Primer_r	: CCCCACTCAGTCACTATGTAC
PCR product length	: 183 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1275 bp
Genome contig ID	gi89161205r_52310069
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- CAATGAATGAATAAAACTCTCCTAAGAATCTCCTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGAAATGAACCCTCCTGTGGTTGCTGGCCTGAGATATGGAGGCTGGGCCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	3	r	52410069	52419058	17	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0272

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information