HUGE

Gene/Protein Characteristic Table for KIAA0276

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK00489
Accession No. :	D87466
Description :	DCN1-like protein 4.
HUGO Gene Name :	DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) (DCUN1D4)
Clone Name :	ha06604 [Vector Info]
Flexi ORF Clone :	pF1KSDA0276
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4185 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3253 bp

Genome contig ID gi89161207f_52304113
PolyA signal sequence
(AATAAA,-28)
+----*----+----*----+----*----+----
TCCCATGAATAAAAAGTATTTGTGTTTGGTTTCAG
Flanking genome sequence
(173647 - 173696)
----+----*----+----*----+----*----+----*----+----*
AACAGATGTGTAAATTTTTTCTTCTCTCTTCTGGCTTTCATTTCAAAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 4 f 52404113 52477758 11 99.2 Perfect prediction

Features of the protein sequence	Description

Length: 309 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAD97912	9.2e-140	100.0	hypothetical pr...	Homo sapiens
XP_001091219	4.2e-138	99.4	DCN1, defective...	Macaca mulatta
Q92564	2.3e-131	100.0	DCN1-like prote...	Homo sapiens
CAL37607	5.1e-131	99.7	hypothetical pr...	synthetic construct
CAL38118	9.7e-131	99.7	hypothetical pr...	synthetic construct

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR005176 190 304 PF03556 Protein of unknown function DUF298

ProfileScan IPR005176 118 304 PS51229 Protein of unknown function DUF298

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005176	190	304	PF03556	Protein of unknown function DUF298
ProfileScan	IPR005176	118	304	PS51229	Protein of unknown function DUF298

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 4

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: TGGGGGTTACTGTTCAATGAC
Primer_r	: CAGGACTTGCACACTTTTATG
PCR product length	: 96 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3253 bp
Genome contig ID	gi89161207f_52304113
PolyA signal sequence (AATAAA,-28)	+--------+--------+----*----+---- TCCCATGAATAAAAAGTATTTGTGTTTGGTTTCAG
Flanking genome sequence (173647 - 173696)	----+--------+--------+--------+--------+----* AACAGATGTGTAAATTTTTTCTTCTCTCTTCTGGCTTTCATTTCAAAAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	4	f	52404113	52477758	11	99.2	Perfect prediction

Gene/Protein Characteristic Table for KIAA0276

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information