HUGE |
Gene/Protein Characteristic Table for KIAA0276 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00489 |
---|---|
Accession No. : | D87466 |
Description : | DCN1-like protein 4. |
HUGO Gene Name : | DCN1, defective in cullin neddylation 1, domain containing 4 (S. cerevisiae) (DCUN1D4) |
Clone Name : | ha06604 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0276
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4185 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3253 bp Genome contig ID gi89161207f_52304113 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
TCCCATGAATAAAAAGTATTTGTGTTTGGTTTCAGFlanking genome sequence
(173647 - 173696) ----+----*----+----*----+----*----+----*----+----*
AACAGATGTGTAAATTTTTTCTTCTCTCTTCTGGCTTTCATTTCAAAAAC
Chr f/r start end exon identity class ContigView(URL based/DAS) 4 f 52404113 52477758 11 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 309 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 4 |
: Genebridge 4 | |
: TGGGGGTTACTGTTCAATGAC | |
: CAGGACTTGCACACTTTTATG | |
: 96 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |