HUGE

Gene/Protein Characteristic Table for KIAA0278

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00491
Accession No. :	D87468
Description :	Activity-regulated cytoskeleton-associated protein.
HUGO Gene Name :	activity-regulated cytoskeleton-associated protein (ARC)
Clone Name :	ha06634 [Vector Info]
Flexi ORF Clone :	pF1KSDA0278
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 2935 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1551 bp

Genome contig ID gi51511724r_143589412
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
TTTGTAAGATTTTGTTAATAAAACACTGAAACTTC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
CTGGAGTGTTCATGTTGTTTCTTCTGTGTGCTTGGGCTGGGCAGGGGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 8 r 143689412 143692815 3 99.0 Terminal No-hit

Features of the protein sequence	Description

Length: 460 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
XP_001090976	9.6e-154	95.2	similar to acti...	Macaca mulatta
Q7LC44	4.5e-138	100.0	Activity-regula...	Homo sapiens
Q9WV31	3.9e-127	92.9	Activity-regula...	Mus musculus
Q63053	1.3e-126	92.7	Activity-regula...	Rattus norvegicus
AAA68695	2.2e-126	92.4	growth factor.	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: Northern blot Description

Northern blot	Description

RH mapping information	Description

Chromosome No.

: 8

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: GACAAGTCTTCAGCCCACACC
Primer_r	: AGGTTTCCAGGGTCTTCACAG
PCR product length	: 126 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1551 bp
Genome contig ID	gi51511724r_143589412
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- TTTGTAAGATTTTGTTAATAAAACACTGAAACTTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* CTGGAGTGTTCATGTTGTTTCTTCTGTGTGCTTGGGCTGGGCAGGGGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	8	r	143689412	143692815	3	99.0	Terminal No-hit

Gene/Protein Characteristic Table for KIAA0278

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information