HUGE |
Gene/Protein Characteristic Table for KIAA0286 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Mapping | |
Product ID : | ORK00495 |
---|---|
Accession No. : | AB006624 |
Description : | |
HUGO Gene Name : | transmembrane protein 194A (TMEM194A) |
Clone Name : | ha06800s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0286 |
Source : | Human adult brain |
Note : | We replaced ha06800, former representative clones for KIAA0286 with ha06800s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5577 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 4235 bp Genome contig ID gi89161190r_55635694 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TTTCTAATTCCAATTTTAATAAAAGTTTTATAGATFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATATTGTGGTCTTTCTTAATGAACATAATATTTTCTTGTTTGGATTTCTT
Chr f/r start end exon identity class ContigView(URL based/DAS) 12 r 55735694 55758802 9 99.2 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 446 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
RH mapping information |
Description | |
---|---|---|
: 12 |
: Genebridge 4 | |
: GATGTTGGTGCCTTATGTGAC | |
: ACTCCCATCTGCCACTAAAGC | |
: 99 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |