HUGE

Gene/Protein Characteristic Table for KIAA0288

Link to : GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :
Accession No. :	AB006626
Description :	Histone deacetylase 4.
HUGO Gene Name :	histone deacetylase 4 (HDAC4)
Clone Name :	ha06116 [Vector Info]
Flexi ORF Clone :	pF1KA0288
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 8459 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 4412 bp

Genome contig ID gi89161199r_239535319
PolyA signal sequence
(ATTAAA,-28)
+----*----+----*----+----*----+----
GGCATTGATTAAAAGTCTGCTATTGAAAGAAAAAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAGCGAACAGTTTTTGTTTGTTTTTTTTGCCGTGTGTGCTCCATAGTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 239635319 239987580 27 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1097 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
P56524	100.0	Histone deacety...	Homo sapiens
EAW71166	99.9	histone deacety...	Homo sapiens
AAX93070	99.9	unknown [Homo s...	Homo sapiens
XP_343630	93.2	similar to hist...	Rattus norvegicus
Q99P99	93.4	Histone deacety...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011172	4.7e-46	52.8	KIAA0600
AB018287	3.3e-42	51.3	KIAA0744
AB020708	1.7e-17	46.0	KIAA0901

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000286 812 835 PR01270 Histone deacetylase superfamily

IPR000286 846 861 PR01270 Histone deacetylase superfamily

IPR000286 937 947 PR01270 Histone deacetylase superfamily

HMMPfam IPR000286 666 1011 PF00850 Histone deacetylase superfamily

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000286	812	835	PR01270	Histone deacetylase superfamily
IPR000286	846	861	PR01270	Histone deacetylase superfamily
IPR000286	937	947	PR01270	Histone deacetylase superfamily
HMMPfam	IPR000286	666	1011	PF00850	Histone deacetylase superfamily

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: Genebridge 4
Primer_f	: CATTCCTTCTTTACTGGTCAC
Primer_r	: AATATAAAGTCATGCCGGTCG
PCR product length	: 187 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	NO

Length of 3'UTR	4412 bp
Genome contig ID	gi89161199r_239535319
PolyA signal sequence (ATTAAA,-28)	+--------+--------+----*----+---- GGCATTGATTAAAAGTCTGCTATTGAAAGAAAAAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAGCGAACAGTTTTTGTTTGTTTTTTTTGCCGTGTGTGCTCCATAGTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	239635319	239987580	27	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0288

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information