HUGE

Gene/Protein Characteristic Table for KIAA0292

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence

Product ID :	ORK07076
Accession No. :	AB006630
Description :	Transcription factor 20.
HUGO Gene Name :
Clone Name :	ha06353 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6542 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1390 bp

Genome contig ID gi89161203r_40786026
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAATCAAAAAAATAATAAACTTCATTTTAACCTTG
Flanking genome sequence
(99937 - 99888)
----+----*----+----*----+----*----+----*----+----*
TTTCCTCTTCTGTTTACTTTAAAGTGAATGCGTCTCTTCCTTCTCCCATT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 r 40885963 40940524 5 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1716 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UGU0	100.0	Transcription f...	Homo sapiens
EAW60495	100.0	transcription f...	Homo sapiens
EAW60498	99.4	transcription f...	Homo sapiens
EAW60497	100.0	transcription f...	Homo sapiens
XP_515168	99.2	transcription f...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058723	8.7e-14	25.6	KIAA1820

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001965 1642 1689 SM00249 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001965	1642	1689	SM00249	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1390 bp
Genome contig ID	gi89161203r_40786026
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAATCAAAAAAATAATAAACTTCATTTTAACCTTG
Flanking genome sequence (99937 - 99888)	----+--------+--------+--------+--------+----* TTTCCTCTTCTGTTTACTTTAAAGTGAATGCGTCTCTTCCTTCTCCCATT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	r	40885963	40940524	5	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0292

Features of the cloned DNA sequence

Features of the protein sequence