HUGE |
Gene/Protein Characteristic Table for KIAA0298 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | |
---|---|
Accession No. : | AB002296 |
Description : | Tripartite motif-containing protein 66. |
HUGO Gene Name : | tripartite motif-containing 66 (TRIM66) |
Clone Name : | hf00341 [Vector Info] |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8001 bp
![]() |
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
cloned DNA seq. | Warning for N-terminal truncation: NO | NO | Warning for coding interruption: YES | YES | |
Length of 3'UTR 3703 bp Genome contig ID gi51511727r_8493662 PolyA signal sequence
(None) +----*----+----*----+----*----+----
TTTGCATGCAAAAACCAGAACATGACTTAGAAATTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAATCCTACTAGCCAAGTGACTGCCTGCAGAGGCTCTTCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 11 r 8593662 8636959 19 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 901 aa
This protein sequence is predicted from the revised DNA sequence
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CGAGAGGCAGGTGTGTAAAGG | |
: ATCAGCTTGCTGGGCCAGAGG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 11 |
: GeneBridge 4 | |
: CGAGAGGCAGGTGTGTAAAGG | |
: ATCAGCTTGCTGGGCCAGAGG | |
: 113 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |