HUGE

Gene/Protein Characteristic Table for KIAA0298

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB002296
Description :	Tripartite motif-containing protein 66.
HUGO Gene Name :	tripartite motif-containing 66 (TRIM66)
Clone Name :	hf00341 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 8001 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
NO NO

Warning for coding interruption:
YES YES

Integrity of 3' end

Length of 3'UTR 3703 bp

Genome contig ID gi51511727r_8493662
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
TTTGCATGCAAAAACCAGAACATGACTTAGAAATT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAATCCTACTAGCCAAGTGACTGCCTGCAGAGGCTCTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 11 r 8593662 8636959 19 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 901 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EAW68621	0	99.9	hCG23889, isofo...	Homo sapiens
NP_055633	0	98.8	tripartite moti...	Homo sapiens
EAW68620	0	98.4	hCG23889, isofo...	Homo sapiens
XP_001097566	9.8e-216	93.7	tripartite moti...	Macaca mulatta
XP_001500723	5.4e-199	87.4	similar to tran...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB029036	2.1e-13	29.9	KIAA1113

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000315 107 124 PR01406 Zinc finger

IPR000315 125 139 PR01406 Zinc finger

HMMPfam IPR000315 93 134 PF00643 Zinc finger

HMMSmart IPR000315 33 71 SM00336 Zinc finger

IPR000315 93 134 SM00336 Zinc finger

IPR003649 141 267 SM00502 B-box

ProfileScan IPR000315 33 79 PS50119 Zinc finger

IPR000315 93 134 PS50119 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	107	124	PR01406	Zinc finger
IPR000315	125	139	PR01406	Zinc finger
HMMPfam	IPR000315	93	134	PF00643	Zinc finger
HMMSmart	IPR000315	33	71	SM00336	Zinc finger
IPR000315	93	134	SM00336	Zinc finger
IPR003649	141	267	SM00502	B-box
ProfileScan	IPR000315	33	79	PS50119	Zinc finger
IPR000315	93	134	PS50119	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CGAGAGGCAGGTGTGTAAAGG

Primer_r
: ATCAGCTTGCTGGGCCAGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CGAGAGGCAGGTGTGTAAAGG
Primer_r	: ATCAGCTTGCTGGGCCAGAGG
PCR product length	: 113 bp
PCR conditions	: 95 °C15 sec70 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	NO	NO
Warning for coding interruption:	YES	YES

Length of 3'UTR	3703 bp
Genome contig ID	gi51511727r_8493662
PolyA signal sequence (None)	+--------+--------+----*----+---- TTTGCATGCAAAAACCAGAACATGACTTAGAAATT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAATCCTACTAGCCAAGTGACTGCCTGCAGAGGCTCTTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	11	r	8593662	8636959	19	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0298

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information