HUGE

Gene/Protein Characteristic Table for KIAA1113

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB029036
Description :	E3 ubiquitin-protein ligase TRIM33.
HUGO Gene Name :	tripartite motif-containing 33 (TRIM33)
Clone Name :	hj06379 [Vector Info]
Flexi ORF Clone :	pF1KA1113
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 4461 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 27 bp

Genome contig ID gi89161185r_114641766
PolyA signal sequence
(AGTAAA,-32)
+----*----+----*----+----*----+----
TAAAGTAAAATGACATGGATTTAAATCAATTGTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAACGAAAAAAAAAAAAAAAACACAAAAAACCCAGAAAAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 1 r 114741766 114855233 20 99.9 Perfect prediction

Features of the protein sequence	Description

Length: 1131 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9UPN9	100.0	E3 ubiquitin-pr...	Homo sapiens
CAI13550	99.9	tripartite moti...	Homo sapiens
AAD17259	99.6	transcriptional...	Homo sapiens
XP_612660	97.6	similar to trip...	Bos taurus
CAB55313	99.5	rfg7 protein [H...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002296	2.8e-18	29.9	KIAA0298

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000315 289 306 PR01406 Zinc finger

IPR000315 307 321 PR01406 Zinc finger

IPR001487 994 1010 PR00503 Bromodomain

IPR001487 1013 1031 PR00503 Bromodomain

IPR001487 1031 1050 PR00503 Bromodomain

HMMPfam IPR000315 216 263 PF00643 Zinc finger

IPR000315 275 316 PF00643 Zinc finger

IPR001965 893 938 PF00628 Zinc finger

IPR001487 966 1055 PF00439 Bromodomain

HMMSmart IPR001965 128 189 SM00249 Zinc finger

IPR001841 129 188 SM00184 Zinc finger

IPR000315 216 263 SM00336 Zinc finger

IPR001841 221 283 SM00184 Zinc finger

IPR000315 275 316 SM00336 Zinc finger

IPR003649 323 449 SM00502 B-box

IPR001965 893 936 SM00249 Zinc finger

IPR001487 963 1086 SM00297 Bromodomain

ProfileScan IPR001841 129 189 PS50089 Zinc finger

IPR000315 216 263 PS50119 Zinc finger

IPR000315 275 316 PS50119 Zinc finger

IPR001965 891 938 PS50016 Zinc finger

IPR001487 978 1050 PS50014 Bromodomain

ScanRegExp IPR001841 149 158 PS00518 Zinc finger

IPR001965 894 935 PS01359 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	289	306	PR01406	Zinc finger
IPR000315	307	321	PR01406	Zinc finger
IPR001487	994	1010	PR00503	Bromodomain
IPR001487	1013	1031	PR00503	Bromodomain
IPR001487	1031	1050	PR00503	Bromodomain
HMMPfam	IPR000315	216	263	PF00643	Zinc finger
IPR000315	275	316	PF00643	Zinc finger
IPR001965	893	938	PF00628	Zinc finger
IPR001487	966	1055	PF00439	Bromodomain
HMMSmart	IPR001965	128	189	SM00249	Zinc finger
IPR001841	129	188	SM00184	Zinc finger
IPR000315	216	263	SM00336	Zinc finger
IPR001841	221	283	SM00184	Zinc finger
IPR000315	275	316	SM00336	Zinc finger
IPR003649	323	449	SM00502	B-box
IPR001965	893	936	SM00249	Zinc finger
IPR001487	963	1086	SM00297	Bromodomain
ProfileScan	IPR001841	129	189	PS50089	Zinc finger
IPR000315	216	263	PS50119	Zinc finger
IPR000315	275	316	PS50119	Zinc finger
IPR001965	891	938	PS50016	Zinc finger
IPR001487	978	1050	PS50014	Bromodomain
ScanRegExp	IPR001841	149	158	PS00518	Zinc finger
IPR001965	894	935	PS01359	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: GGGAAAGCAGTTGCATTGTAC

Primer_r
: GTCCTCAGTTACCTCACCATC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 1

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GGGAAAGCAGTTGCATTGTAC
Primer_r	: GTCCTCAGTTACCTCACCATC
PCR product length	: 117 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	27 bp
Genome contig ID	gi89161185r_114641766
PolyA signal sequence (AGTAAA,-32)	+--------+--------+----*----+---- TAAAGTAAAATGACATGGATTTAAATCAATTGTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAACGAAAAAAAAAAAAAAAACACAAAAAACCCAGAAAAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	1	r	114741766	114855233	20	99.9	Perfect prediction

Gene/Protein Characteristic Table for KIAA1113

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information