HUGE

Gene/Protein Characteristic Table for KIAA0311

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00049
Accession No. :	AB002309
Description :	A-kinase anchor protein 6.
HUGO Gene Name :	A kinase (PRKA) anchor protein 6 (AKAP6)
Clone Name :	hg00112s1 [Vector Info]
Flexi ORF Clone :	pF1KA0311
Source :	Human adult brain
Note :	We replaced hg00112, former representative clones for KIAA0311 with hg00112s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 10327 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3257 bp

Genome contig ID gi51511730f_31768290
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
ATTGTAAATTTCAAACAATAAATAAATAAGAATCC
Flanking genome sequence
(603730 - 603779)
----+----*----+----*----+----*----+----*----+----*
ATGACTTCCTTCAGTGGCCCAGTCCAGTGCCTAAGTCATCTGGAATCTTC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 31868290 32372018 14 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 2324 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q13023	100.0	A-kinase anchor...	Homo sapiens
AAI37233	99.9	A kinase (PRKA)...	Homo sapiens
AAA92354	99.9	A-kinase anchor...	Homo sapiens
XP_509893	99.1	A-kinase anchor...	Pan troglodytes
XP_001115172	97.4	similar to A-ki...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB011154	5.5e-06	23.0	KIAA0582

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR002017 787 888 SM00150 Spectrin repeat

IPR002017 967 1065 SM00150 Spectrin repeat

IPR002017 1086 1194 SM00150 Spectrin repeat

ScanRegExp IPR002173 2206 2219 PS00584 Carbohydrate kinase

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR002017	787	888	SM00150	Spectrin repeat
IPR002017	967	1065	SM00150	Spectrin repeat
IPR002017	1086	1194	SM00150	Spectrin repeat
ScanRegExp	IPR002173	2206	2219	PS00584	Carbohydrate kinase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCAGTCAGGTTGGAATGGATC

Primer_r
: CTCTTTCTCATGGCAACCCTG

PCR conditions
: 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCAGTCAGGTTGGAATGGATC
Primer_r	: CTCTTTCTCATGGCAACCCTG
PCR product length	: 118 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	3257 bp
Genome contig ID	gi51511730f_31768290
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- ATTGTAAATTTCAAACAATAAATAAATAAGAATCC
Flanking genome sequence (603730 - 603779)	----+--------+--------+--------+--------+----* ATGACTTCCTTCAGTGGCCCAGTCCAGTGCCTAAGTCATCTGGAATCTTC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	31868290	32372018	14	99.7	Perfect prediction

Gene/Protein Characteristic Table for KIAA0311

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information