HUGE

Gene/Protein Characteristic Table for KIAA0314

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04254
Accession No. :	AB002312
Description :	Bromodomain adjacent to zinc finger domain protein 2A.
HUGO Gene Name :	bromodomain adjacent to zinc finger domain, 2A (BAZ2A)
Clone Name :	af02425 [Vector Info]
Source :	Human brain (amygdala)
Note :	We replaced hg00235, former representative clones for KIAA0314 with af02425. (2005/08/06)

Features of the cloned DNA sequence	Description

Length: 7440 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1739 bp

Genome contig ID gi89161190r_55176005
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
TCAGTTGTTGAATAAAAAAACCACATTTGATAGAG
Flanking genome sequence
(99977 - 99928)
----+----*----+----*----+----*----+----*----+----*
ATTCAAAAGACTCTGTGTATTCATCTTCCCTTCTACACACCTGAGGGGGA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 12 r 55275982 55297570 29 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1899 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI52740	100.0	Bromodomain adj...	synthetic construct
CAH18232	99.8	hypothetical pr...	Homo sapiens
XP_509537	99.6	bromodomain adj...	Pan troglodytes
XP_001115300	98.3	bromodomain adj...	Macaca mulatta
XP_001504899	92.4	similar to Brom...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB040909	3e-17	36.5	KIAA1476

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000637 1180 1190 PR00929 HMG-I and HMG-Y

IPR000637 1349 1360 PR00929 HMG-I and HMG-Y

IPR000637 1396 1406 PR00929 HMG-I and HMG-Y

IPR001487 1807 1820 PR00503 Bromodomain

IPR001487 1821 1837 PR00503 Bromodomain

IPR001487 1837 1855 PR00503 Bromodomain

IPR001487 1855 1874 PR00503 Bromodomain

HMMPfam IPR001739 540 614 PF01429 Methyl-CpG binding

IPR000637 643 655 PF02178 HMG-I and HMG-Y

IPR000637 664 676 PF02178 HMG-I and HMG-Y

IPR004022 843 904 PF02791 DDT

IPR000637 1180 1192 PF02178 HMG-I and HMG-Y

IPR000637 1398 1410 PF02178 HMG-I and HMG-Y

IPR001965 1672 1720 PF00628 Zinc finger

IPR001487 1795 1879 PF00439 Bromodomain

HMMSmart IPR001739 543 618 SM00391 Methyl-CpG binding

IPR000637 643 655 SM00384 HMG-I and HMG-Y

IPR000637 664 676 SM00384 HMG-I and HMG-Y

IPR004022 842 907 SM00571 DDT

IPR000637 1180 1192 SM00384 HMG-I and HMG-Y

IPR000637 1398 1410 SM00384 HMG-I and HMG-Y

IPR001965 1672 1718 SM00249 Zinc finger

IPR001487 1785 1893 SM00297 Bromodomain

ProfileScan IPR001739 540 611 PS50982 Methyl-CpG binding

IPR004022 842 907 PS50827 DDT

IPR001965 1670 1720 PS50016 Zinc finger

IPR001487 1804 1874 PS50014 Bromodomain

ScanRegExp IPR001487 1809 1866 PS00633 Bromodomain

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000637	1180	1190	PR00929	HMG-I and HMG-Y
IPR000637	1349	1360	PR00929	HMG-I and HMG-Y
IPR000637	1396	1406	PR00929	HMG-I and HMG-Y
IPR001487	1807	1820	PR00503	Bromodomain
IPR001487	1821	1837	PR00503	Bromodomain
IPR001487	1837	1855	PR00503	Bromodomain
IPR001487	1855	1874	PR00503	Bromodomain
HMMPfam	IPR001739	540	614	PF01429	Methyl-CpG binding
IPR000637	643	655	PF02178	HMG-I and HMG-Y
IPR000637	664	676	PF02178	HMG-I and HMG-Y
IPR004022	843	904	PF02791	DDT
IPR000637	1180	1192	PF02178	HMG-I and HMG-Y
IPR000637	1398	1410	PF02178	HMG-I and HMG-Y
IPR001965	1672	1720	PF00628	Zinc finger
IPR001487	1795	1879	PF00439	Bromodomain
HMMSmart	IPR001739	543	618	SM00391	Methyl-CpG binding
IPR000637	643	655	SM00384	HMG-I and HMG-Y
IPR000637	664	676	SM00384	HMG-I and HMG-Y
IPR004022	842	907	SM00571	DDT
IPR000637	1180	1192	SM00384	HMG-I and HMG-Y
IPR000637	1398	1410	SM00384	HMG-I and HMG-Y
IPR001965	1672	1718	SM00249	Zinc finger
IPR001487	1785	1893	SM00297	Bromodomain
ProfileScan	IPR001739	540	611	PS50982	Methyl-CpG binding
IPR004022	842	907	PS50827	DDT
IPR001965	1670	1720	PS50016	Zinc finger
IPR001487	1804	1874	PS50014	Bromodomain
ScanRegExp	IPR001487	1809	1866	PS00633	Bromodomain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ACAGACAACCGCCCCCTAAAG

Primer_r
: TCTGCCTCATCTTCTTCTTGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 12

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ACAGACAACCGCCCCCTAAAG
Primer_r	: TCTGCCTCATCTTCTTCTTGC
PCR product length	: 97 (2.5k) bp
PCR conditions	: 95 °C15 sec64 °C120 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1739 bp
Genome contig ID	gi89161190r_55176005
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- TCAGTTGTTGAATAAAAAAACCACATTTGATAGAG
Flanking genome sequence (99977 - 99928)	----+--------+--------+--------+--------+----* ATTCAAAAGACTCTGTGTATTCATCTTCCCTTCTACACACCTGAGGGGGA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	12	r	55275982	55297570	29	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0314

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information