HUGE

Gene/Protein Characteristic Table for KIAA1476

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Mapping

Product ID :	ORK04255
Accession No. :	AB040909
Description :	Bromodomain adjacent to zinc finger domain protein 2B.
HUGO Gene Name :
Clone Name :	fj04778s1 [Vector Info]
Source :	Human fetal brain
Note :	We replaced fj04778, former representative clones for KIAA1476 with fj04778s1. (2003/4/2)

Features of the cloned DNA sequence	Description

Length: 7985 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1213 bp

Genome contig ID gi89161199r_159783809
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AAGTTTTATTTAAAATAAAATGTTGTGGAAAAGGT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGCATTCTTTTTTTAGGAGTGTTATTTTTCACTATGTGTGGCACGGATAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 r 159883809 160181326 36 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2142 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_856656	96.0	similar to Brom...	Canis lupus fam...
XP_848667	94.5	similar to Brom...	Canis lupus fam...
XP_856693	92.0	similar to Brom...	Canis lupus fam...
CAM26914	84.4	bromodomain adj...	Mus musculus
EAX11404	98.3	bromodomain adj...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002312	1.2e-17	36.6	KIAA0314

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR001487 2054 2067 PR00503 Bromodomain

IPR001487 2068 2084 PR00503 Bromodomain

IPR001487 2084 2102 PR00503 Bromodomain

IPR001487 2102 2121 PR00503 Bromodomain

HMMPfam IPR001739 747 796 PF01429 Methyl-CpG binding

IPR004022 1062 1123 PF02791 DDT

IPR001965 1907 1955 PF00628 Zinc finger

IPR001487 2038 2126 PF00439 Bromodomain

HMMSmart IPR001739 750 820 SM00391 Methyl-CpG binding

IPR004022 1061 1126 SM00571 DDT

IPR001965 1907 1953 SM00249 Zinc finger

IPR001487 2032 2140 SM00297 Bromodomain

ProfileScan IPR001739 747 822 PS50982 Methyl-CpG binding

IPR004022 1061 1126 PS50827 DDT

IPR001965 1905 1955 PS50016 Zinc finger

IPR001487 2051 2121 PS50014 Bromodomain

ScanRegExp IPR001487 2056 2113 PS00633 Bromodomain

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001487	2054	2067	PR00503	Bromodomain
IPR001487	2068	2084	PR00503	Bromodomain
IPR001487	2084	2102	PR00503	Bromodomain
IPR001487	2102	2121	PR00503	Bromodomain
HMMPfam	IPR001739	747	796	PF01429	Methyl-CpG binding
IPR004022	1062	1123	PF02791	DDT
IPR001965	1907	1955	PF00628	Zinc finger
IPR001487	2038	2126	PF00439	Bromodomain
HMMSmart	IPR001739	750	820	SM00391	Methyl-CpG binding
IPR004022	1061	1126	SM00571	DDT
IPR001965	1907	1953	SM00249	Zinc finger
IPR001487	2032	2140	SM00297	Bromodomain
ProfileScan	IPR001739	747	822	PS50982	Methyl-CpG binding
IPR004022	1061	1126	PS50827	DDT
IPR001965	1905	1955	PS50016	Zinc finger
IPR001487	2051	2121	PS50014	Bromodomain
ScanRegExp	IPR001487	2056	2113	PS00633	Bromodomain

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TAGTCTTTTGCCACGAACACC
Primer_r	: AGATACTCCACCTTTCACCTG
PCR product length	: 202(600) bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1213 bp
Genome contig ID	gi89161199r_159783809
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AAGTTTTATTTAAAATAAAATGTTGTGGAAAAGGT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGCATTCTTTTTTTAGGAGTGTTATTTTTCACTATGTGTGGCACGGATAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	r	159883809	160181326	36	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA1476

Features of the cloned DNA sequence

Features of the protein sequence

RH mapping information