HUGE

Gene/Protein Characteristic Table for KIAA0316

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00502
Accession No. :	AB002314
Description :	FERM and PDZ domain containing 4.
HUGO Gene Name :	FERM and PDZ domain containing 4 (FRMPD4)
Clone Name :	fg06820 [Vector Info]
Flexi ORF Clone :	pF1KSDA0316
Source :	Human fetal brain
Note :	We replaced hg00253, former representative clones for KIAA0316 with fg06820. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 6352 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1877 bp

Genome contig ID gi89161218f_11966506
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
AGAATATATCTGTAATAAATTAATTTTTTGCTCAT
Flanking genome sequence
(683946 - 683995)
----+----*----+----*----+----*----+----*----+----*
AGTATTTGGTTACTGGATGCTTTCTTCCAAGAATCCCACATATTTAATTT

Features of the protein sequence	Description

Length: 1379 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09702	100.0	FERM and PDZ do...	synthetic construct
Q14CM0	99.9	FERM and PDZ do...	Homo sapiens
EAW98804	99.8	FERM and PDZ do...	Homo sapiens
AAI43747	99.8	FRMPD4 protein ...	Homo sapiens
XP_001095042	98.4	similar to PDZ ...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023184	8e-55	30.1	KIAA0967

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001478 144 209 PF00595 PDZ/DHR/GLGF

HMMSmart IPR001478 142 212 SM00228 PDZ/DHR/GLGF

IPR000299 259 481 SM00295 Band 4.1

ProfileScan IPR001202 90 123 PS50020 WW/Rsp5/WWP

IPR001478 135 212 PS50106 PDZ/DHR/GLGF

IPR000299 261 576 PS50057 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001478	144	209	PF00595	PDZ/DHR/GLGF
HMMSmart	IPR001478	142	212	SM00228	PDZ/DHR/GLGF
IPR000299	259	481	SM00295	Band 4.1
ProfileScan	IPR001202	90	123	PS50020	WW/Rsp5/WWP
IPR001478	135	212	PS50106	PDZ/DHR/GLGF
IPR000299	261	576	PS50057	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GATTTTGTCCCAGTACTACGC

Primer_r
: CAGTAATGTAGACCAGACCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 13

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GATTTTGTCCCAGTACTACGC
Primer_r	: CAGTAATGTAGACCAGACCAC
PCR product length	: 148 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1877 bp
Genome contig ID	gi89161218f_11966506
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- AGAATATATCTGTAATAAATTAATTTTTTGCTCAT
Flanking genome sequence (683946 - 683995)	----+--------+--------+--------+--------+----* AGTATTTGGTTACTGGATGCTTTCTTCCAAGAATCCCACATATTTAATTT

Gene/Protein Characteristic Table for KIAA0316

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information