HUGE |
Gene/Protein Characteristic Table for KIAA0316 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00502 |
---|---|
Accession No. : | AB002314 |
Description : | FERM and PDZ domain containing 4. |
HUGO Gene Name : | FERM and PDZ domain containing 4 (FRMPD4) |
Clone Name : | fg06820 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0316
![]() |
Source : | Human fetal brain |
Note : | We replaced hg00253, former representative clones for KIAA0316 with fg06820. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6352 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 1877 bp Genome contig ID gi89161218f_11966506 PolyA signal sequence
(AATAAA,-22) +----*----+----*----+----*----+----
AGAATATATCTGTAATAAATTAATTTTTTGCTCATFlanking genome sequence
(683946 - 683995) ----+----*----+----*----+----*----+----*----+----*
AGTATTTGGTTACTGGATGCTTTCTTCCAAGAATCCCACATATTTAATTT
Features of the protein sequence |
Description | |
---|---|---|
Length: 1379 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GATTTTGTCCCAGTACTACGC | |
: CAGTAATGTAGACCAGACCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 13 |
: GeneBridge 4 | |
: GATTTTGTCCCAGTACTACGC | |
: CAGTAATGTAGACCAGACCAC | |
: 148 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |