HUGE

Gene/Protein Characteristic Table for KIAA0328

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04086
Accession No. :	AB002326
Description :	Alstrom syndrome protein 1.
HUGO Gene Name :	Alstrom syndrome 1 (ALMS1)
Clone Name :	hg00685s2 [Vector Info]
Source :	Human adult brain
Note :	We replaced hg00685, former representative clones for KIAA0328 with hg00685s2. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 6720 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 551 bp

Genome contig ID gi89161199f_73433360
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
ACTCCAGTCTGGGCGACAGAACGAGACTCCATCTC
Flanking genome sequence
(251136 - 251185)
----+----*----+----*----+----*----+----*----+----*
AAAAAAATTAAAAAAAAAGATTATTTTGAAATAAAATTAAATATGTATTT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 2 f 73533360 73684494 14 99.8 Perfect prediction

Features of the protein sequence	Description

Length: 2055 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW99730	100.0	Alstrom syndrom...	Homo sapiens
Q8TCU4	100.0	Alstrom syndrom...	Homo sapiens
NP_055935	100.0	ALMS1 [Homo sap...	Homo sapiens
CAD10391	100.0	ALMS1 protein [...	Homo sapiens
XP_001105030	94.9	similar to ALMS...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TGCAGGTTTTAGAGATGTTGG

Primer_r
: TCTGCCTCCATCAAAAGTGTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 2

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TGCAGGTTTTAGAGATGTTGG
Primer_r	: TCTGCCTCCATCAAAAGTGTC
PCR product length	: 96 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	551 bp
Genome contig ID	gi89161199f_73433360
PolyA signal sequence (None)	+--------+--------+----*----+---- ACTCCAGTCTGGGCGACAGAACGAGACTCCATCTC
Flanking genome sequence (251136 - 251185)	----+--------+--------+--------+--------+----* AAAAAAATTAAAAAAAAAGATTATTTTGAAATAAAATTAAATATGTATTT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	2	f	73533360	73684494	14	99.8	Perfect prediction

Gene/Protein Characteristic Table for KIAA0328

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information