HUGE |
Gene/Protein Characteristic Table for KIAA0338 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01069 |
---|---|
Accession No. : | AB002336 |
Description : | Band 4.1-like protein 1. |
HUGO Gene Name : | erythrocyte membrane protein band 4.1-like 1 (EPB41L1) |
Clone Name : | hg01242 [Vector Info] |
Flexi ORF Clone : | pF1KA0338
![]() |
Source : | Human adult brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6263 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3456 bp Genome contig ID gi51511747f_34106086 PolyA signal sequence
(AATAAA,-26) +----*----+----*----+----*----+----
TATAAGTGAAATAAATGTGTTTGATGCTGAACCATFlanking genome sequence
(178050 - 178099) ----+----*----+----*----+----*----+----*----+----*
ACTTCCTTGGCACCTCTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 20 f 34206086 34284134 22 99.4 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 934 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CCCAGAAATCGCCCCAGAAGA | |
: GGCCATGTTTCTCCACCTCAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 20 |
: GeneBridge 4 | |
: CCCAGAAATCGCCCCAGAAGA | |
: GGCCATGTTTCTCCACCTCAC | |
: 105 bp | |
: 95 °C |
How to obtain KIAA clone(s) How to obtain anti KIAA antibodies Back to the HUGE Protein Database homepage ![]() | |