HUGE

Gene/Protein Characteristic Table for KIAA0338

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01069
Accession No. :	AB002336
Description :	Band 4.1-like protein 1.
HUGO Gene Name :	erythrocyte membrane protein band 4.1-like 1 (EPB41L1)
Clone Name :	hg01242 [Vector Info]
Flexi ORF Clone :	pF1KA0338
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6263 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3456 bp

Genome contig ID gi51511747f_34106086
PolyA signal sequence
(AATAAA,-26)
+----*----+----*----+----*----+----
TATAAGTGAAATAAATGTGTTTGATGCTGAACCAT
Flanking genome sequence
(178050 - 178099)
----+----*----+----*----+----*----+----*----+----*
ACTTCCTTGGCACCTCTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 20 f 34206086 34284134 22 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 934 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9H4G0	100.0	Band 4.1-like p...	Homo sapiens
AAH40259	99.9	EPB41L1 protein...	Homo sapiens
AAL15446	99.9	erythrocyte mem...	Homo sapiens
XP_001501956	96.7	erythrocyte mem...	Equus caballus
XP_872829	96.1	similar to EPB4...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023204	1e-65	43.0	KIAA0987
AB018336	1.5e-23	34.6	KIAA0793
AB046768	2e-12	34.9	KIAA1548

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000798 163 182 PR00661 Ezrin/radixin/moesin ERM

IPR000299 183 195 PR00935 Band 4.1

IPR000798 213 232 PR00661 Ezrin/radixin/moesin ERM

IPR000299 247 260 PR00935 Band 4.1

IPR000798 256 277 PR00661 Ezrin/radixin/moesin ERM

IPR000299 260 280 PR00935 Band 4.1

IPR000299 321 337 PR00935 Band 4.1

IPR000798 344 364 PR00661 Ezrin/radixin/moesin ERM

HMMPfam IPR000299 152 341 PF00373 Band 4.1

IPR014847 435 483 PF08736 FERM adjacent (FA)

IPR007477 531 597 PF04382 SAB

IPR008379 830 922 PF05902 Band 4.1

HMMSmart IPR000299 146 341 SM00295 Band 4.1

ProfileScan IPR000299 150 431 PS50057 Band 4.1

ScanRegExp IPR000299 204 232 PS00660 Band 4.1

IPR000299 311 340 PS00661 Band 4.1

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000798	163	182	PR00661	Ezrin/radixin/moesin ERM
IPR000299	183	195	PR00935	Band 4.1
IPR000798	213	232	PR00661	Ezrin/radixin/moesin ERM
IPR000299	247	260	PR00935	Band 4.1
IPR000798	256	277	PR00661	Ezrin/radixin/moesin ERM
IPR000299	260	280	PR00935	Band 4.1
IPR000299	321	337	PR00935	Band 4.1
IPR000798	344	364	PR00661	Ezrin/radixin/moesin ERM
HMMPfam	IPR000299	152	341	PF00373	Band 4.1
IPR014847	435	483	PF08736	FERM adjacent (FA)
IPR007477	531	597	PF04382	SAB
IPR008379	830	922	PF05902	Band 4.1
HMMSmart	IPR000299	146	341	SM00295	Band 4.1
ProfileScan	IPR000299	150	431	PS50057	Band 4.1
ScanRegExp	IPR000299	204	232	PS00660	Band 4.1
IPR000299	311	340	PS00661	Band 4.1

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCCAGAAATCGCCCCAGAAGA

Primer_r
: GGCCATGTTTCTCCACCTCAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 20

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CCCAGAAATCGCCCCAGAAGA
Primer_r	: GGCCATGTTTCTCCACCTCAC
PCR product length	: 105 bp
PCR conditions	: 95 °C15 sec66 °C60 sec30 cycles

How to obtain KIAA clone(s) How to obtain anti KIAA antibodies Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3456 bp
Genome contig ID	gi51511747f_34106086
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- TATAAGTGAAATAAATGTGTTTGATGCTGAACCAT
Flanking genome sequence (178050 - 178099)	----+--------+--------+--------+--------+----* ACTTCCTTGGCACCTCTCCTCTCTCTCTCTCTCTCTCTCTCTCTCTCTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	20	f	34206086	34284134	22	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0338

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information