HUGE |
Gene/Protein Characteristic Table for KIAA0342 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK05593 |
---|---|
Accession No. : | AB002340 |
Description : | lupus brain antigen 1. |
HUGO Gene Name : | |
Clone Name : | bf03307 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hg03234, former representative clones for KIAA0342 with bf03307. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 8859 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1455 bp Genome contig ID gi89161205r_36743315 PolyA signal sequence
(TATAAA,-23) +----*----+----*----+----*----+----
TATCACATTTTTTATAAAGTTAAAGCATTTCTCTTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACATGCTGCCGTTTTATTTCCAGTCTCTACTCAGAGTAAGGGGGTAAATC
Chr f/r start end exon identity class ContigView(URL based/DAS) 3 r 36843315 36875378 13 99.5 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2467 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AGCAGCATGAGCAGCAAAAGC | |
: CCTCTCTGATGGTTACTGCCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 3 |
: GeneBridge 4 | |
: AGCAGCATGAGCAGCAAAAGC | |
: CCTCTCTGATGGTTACTGCCC | |
: 150 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |