| HUGE |
Gene/Protein Characteristic Table for KIAA0346 |
|
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
| Features : DNA sequence | Protein sequence | Expression | Mapping | |
| Product ID : | ORK00511 |
|---|---|
| Accession No. : | AB002344 |
| Description : | JmjC domain-containing protein 3. |
| HUGO Gene Name : | jumonji domain containing 3, histone lysine demethylase (JMJD3) |
| Clone Name : | hg01508s1 [Vector Info] |
| Flexi ORF Clone : | pF1KSDA0346
|
| Source : | Human adult brain |
| Note : | We replaced hg01508, former representative clones for KIAA0346 with hg01508s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 6698 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1268 bp Genome contig ID gi51511734f_7583967 PolyA signal sequence
(AATAAA,-11)
TTGTGTGAGAATATTAATATTAAAAATAAACGGAGFlanking genome sequence
(114866 - 114915)
AAAAAAAATCCTGTTTCGCTAACGGCTGGTGGTAGCAGGTTGAGTACCGG
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 f 7683953 7698831 22 99.5 Terminal No-hit
Features of the protein sequence |
Description | |
|---|---|---|
Length: 1682 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
|---|---|---|
| RT-PCR | Description |
|---|
| : CGAAAATAGGGGTAGGGTTGG | |
| : TTCTCTGGGGCTTTATTTTCG | |
| : 95 °C |
RH mapping information |
Description | |
|---|---|---|
| : 17 |
| : GeneBridge 4 | |
| : CGAAAATAGGGGTAGGGTTGG | |
| : TTCTCTGGGGCTTTATTTTCG | |
| : 151 bp | |
| : 95 °C |
|
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage 
| |
