HUGE

Gene/Protein Characteristic Table for KIAA0353

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00513
Accession No. :	AB002351
Description :	Desmuslin.
HUGO Gene Name :	synemin, intermediate filament protein (SYNM)
Clone Name :	hg01758y1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0353
Source :	Human adult brain
Note :	We replaced hg01758, former representative clones for KIAA0353 with hg01758y1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 7381 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2525 bp

Genome contig ID gi51511731f_97362771
PolyA signal sequence
(AATAAA,-15)
+----*----+----*----+----*----+----
ATGTCACAAGAATGTGCAAAAATAAAAATCTGAGG
Flanking genome sequence
(130542 - 130591)
----+----*----+----*----+----*----+----*----+----*
AAAAAACCCACATTGTTCCTAAAGAGAATGAATATTTTCAGTAGATTTTG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 15 f 97462771 97493311 4 99.0 Perfect prediction

Features of the protein sequence	Description

Length: 1614 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAI51244	100.0	Desmuslin [Homo...	Homo sapiens
O15061	99.9	Synemin; Desmuslin.	Homo sapiens
EAX02231	99.7	desmuslin, isof...	Homo sapiens
CAC83859	98.3	synemin [Homo s...	Homo sapiens
XP_001108469	93.7	desmuslin [Maca...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB020652	5.6e-10	25.1	KIAA0845

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001664 59 370 PF00038 Intermediate filament protein

ScanRegExp IPR001664 357 365 PS00226 Intermediate filament protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001664	59	370	PF00038	Intermediate filament protein
ScanRegExp	IPR001664	357	365	PS00226	Intermediate filament protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: TCAAAACCACCAGTAGGAAAC

Primer_r
: CTGCACACAAGAGAAATCAAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 15

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TCAAAACCACCAGTAGGAAAC
Primer_r	: CTGCACACAAGAGAAATCAAC
PCR product length	: 128 bp
PCR conditions	: 95 °C15 sec60 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2525 bp
Genome contig ID	gi51511731f_97362771
PolyA signal sequence (AATAAA,-15)	+--------+--------+----*----+---- ATGTCACAAGAATGTGCAAAAATAAAAATCTGAGG
Flanking genome sequence (130542 - 130591)	----+--------+--------+--------+--------+----* AAAAAACCCACATTGTTCCTAAAGAGAATGAATATTTTCAGTAGATTTTG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	15	f	97462771	97493311	4	99.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0353

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information