HUGE |
Gene/Protein Characteristic Table for KIAA0353 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00513 |
---|---|
Accession No. : | AB002351 |
Description : | Desmuslin. |
HUGO Gene Name : | synemin, intermediate filament protein (SYNM) |
Clone Name : | hg01758y1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0353
![]() |
Source : | Human adult brain |
Note : | We replaced hg01758, former representative clones for KIAA0353 with hg01758y1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 7381 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2525 bp Genome contig ID gi51511731f_97362771 PolyA signal sequence
(AATAAA,-15) +----*----+----*----+----*----+----
ATGTCACAAGAATGTGCAAAAATAAAAATCTGAGGFlanking genome sequence
(130542 - 130591) ----+----*----+----*----+----*----+----*----+----*
AAAAAACCCACATTGTTCCTAAAGAGAATGAATATTTTCAGTAGATTTTG
Chr f/r start end exon identity class ContigView(URL based/DAS) 15 f 97462771 97493311 4 99.0 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 1614 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: TCAAAACCACCAGTAGGAAAC | |
: CTGCACACAAGAGAAATCAAC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 15 |
: GeneBridge 4 | |
: TCAAAACCACCAGTAGGAAAC | |
: CTGCACACAAGAGAAATCAAC | |
: 128 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |