HUGE |
Gene/Protein Characteristic Table for KIAA0845 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00655 |
---|---|
Accession No. : | AB020652 |
Description : | Neurofilament heavy polypeptide. |
HUGO Gene Name : | |
Clone Name : | hk05234s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0845
![]() |
Source : | Human adult brain |
Note : | We replaced hk05234, former representative clones for KIAA0845 with hk05234s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3929 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 583 bp Genome contig ID gi89161203f_28106243 PolyA signal sequence
(AATAAA,-25) +----*----+----*----+----*----+----
GCTTTTGTGCAATAAAACCAAGTGCTTATAAAATGFlanking genome sequence
(111034 - 111083) ----+----*----+----*----+----*----+----*----+----*
AAAATGTTGCTGCTGTTATTCTCTTTCCCTGGGAAGGCTGGGGGCAGGGC
Chr f/r start end exon identity class ContigView(URL based/DAS) 22 f 28196907 28217275 9 98.6 Internal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1034 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: TGAGATGTCTTAACCTATTCC | |
: AAGCAATTGAAAGTGAACTCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 22 |
: UniGene | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |