HUGE

Gene/Protein Characteristic Table for KIAA0845

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00655
Accession No. :	AB020652
Description :	Neurofilament heavy polypeptide.
HUGO Gene Name :
Clone Name :	hk05234s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0845
Source :	Human adult brain
Note :	We replaced hk05234, former representative clones for KIAA0845 with hk05234s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 3929 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 583 bp

Genome contig ID gi89161203f_28106243
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GCTTTTGTGCAATAAAACCAAGTGCTTATAAAATG
Flanking genome sequence
(111034 - 111083)
----+----*----+----*----+----*----+----*----+----*
AAAATGTTGCTGCTGTTATTCTCTTTCCCTGGGAAGGCTGGGGGCAGGGC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 22 f 28196907 28217275 9 98.6 Internal No-hit

Features of the protein sequence	Description

Length: 1034 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAF13722	0	100.0	neurofilament p...	Homo sapiens
P12036	0	99.9	Neurofilament h...	Homo sapiens
BAG63896	0	100.0	unnamed protein...	Homo sapiens
EAW59805	0	99.4	neurofilament, ...	Homo sapiens
CAA33366	7.2e-217	99.3	heavy neurofila...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB002351	0.00046	25.1	KIAA0353

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001664 104 420 PF00038 Intermediate filament protein

IPR010790 549 579 PF07142 Protein of unknown function DUF1388

IPR010790 583 613 PF07142 Protein of unknown function DUF1388

IPR010790 618 647 PF07142 Protein of unknown function DUF1388

ScanRegExp IPR001664 407 415 PS00226 Intermediate filament protein

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001664	104	420	PF00038	Intermediate filament protein
IPR010790	549	579	PF07142	Protein of unknown function DUF1388
IPR010790	583	613	PF07142	Protein of unknown function DUF1388
IPR010790	618	647	PF07142	Protein of unknown function DUF1388
ScanRegExp	IPR001664	407	415	PS00226	Intermediate filament protein

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: TGAGATGTCTTAACCTATTCC

Primer_r
: AAGCAATTGAAAGTGAACTCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 22

Experimental conditions

Panel name	: UniGene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	583 bp
Genome contig ID	gi89161203f_28106243
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GCTTTTGTGCAATAAAACCAAGTGCTTATAAAATG
Flanking genome sequence (111034 - 111083)	----+--------+--------+--------+--------+----* AAAATGTTGCTGCTGTTATTCTCTTTCCCTGGGAAGGCTGGGGGCAGGGC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	22	f	28196907	28217275	9	98.6	Internal No-hit

Primer_f	: TGAGATGTCTTAACCTATTCC
Primer_r	: AAGCAATTGAAAGTGAACTCC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0845

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information