HUGE

Gene/Protein Characteristic Table for KIAA0355

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00514
Accession No. :	AB002353
Description :
HUGO Gene Name :
Clone Name :	hg01881 [Vector Info]
Flexi ORF Clone :	pF1KSDA0355
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6657 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2606 bp

Genome contig ID gi42406306f_39337317
PolyA signal sequence
(ATTAAA,-20)
+----*----+----*----+----*----+----
ATAACTATTGGCTTTATTAAAAATATACATTTAAT
Flanking genome sequence
(200992 - 201041)
----+----*----+----*----+----*----+----*----+----*
AATACTTTGTATCCTTGTTTAAAATGAACTGCAGAGGACATTATGTCAAA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 19 f 39437317 39538307 14 99.4 Perfect prediction

Features of the protein sequence	Description

Length: 1082 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAH89862	99.0	hypothetical pr...	Pongo abelii
BAE02416	99.0	unnamed protein...	Macaca fascicularis
XP_001914828	95.2	hypothetical pr...	Equus caballus
XP_875223	94.9	hypothetical pr...	Bos taurus
XP_001090089	99.0	hypothetical pr...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CACAATGTCCTGCTGATGCCC

Primer_r
: GTAATTCCAGGTGTGCGCTTG

PCR conditions
: 95 °C30 sec61 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 19

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CACAATGTCCTGCTGATGCCC
Primer_r	: GTAATTCCAGGTGTGCGCTTG
PCR product length	: 125 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	2606 bp
Genome contig ID	gi42406306f_39337317
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- ATAACTATTGGCTTTATTAAAAATATACATTTAAT
Flanking genome sequence (200992 - 201041)	----+--------+--------+--------+--------+----* AATACTTTGTATCCTTGTTTAAAATGAACTGCAGAGGACATTATGTCAAA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	19	f	39437317	39538307	14	99.4	Perfect prediction

Gene/Protein Characteristic Table for KIAA0355

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information