HUGE

Gene/Protein Characteristic Table for KIAA0356

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01072
Accession No. :	AB002354
Description :	pleckstrin homology domain containing, family M (with RUN domain) member 1.
HUGO Gene Name :	pleckstrin homology domain containing, family M (with RUN domain) member 1 (PLEKHM1)
Clone Name :	hh00006s1 [Vector Info]
Flexi ORF Clone :	pF1KA0356
Source :	Human adult brain
Note :	We replaced hh00006, former representative clones for KIAA0356 with hh00006s1. (2002/12/27)

Features of the cloned DNA sequence	Description

Length: 5248 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1058 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9Y4G2	100.0	Pleckstrin homo...	Homo sapiens
XP_001140498	99.0	pleckstrin homo...	Pan troglodytes
BAG61171	99.8	unnamed protein...	Homo sapiens
XP_001140336	92.6	pleckstrin homo...	Pan troglodytes
XP_001140582	97.2	pleckstrin homo...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86979	5e-14	22.6	KIAA0226
AB020649	0.00012	25.1	KIAA0842

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004012 51 185 PF02759 RUN

IPR001849 537 627 PF00169 Pleckstrin-like

HMMSmart IPR004012 120 183 SM00593 RUN

IPR001849 537 629 SM00233 Pleckstrin-like

IPR001849 686 781 SM00233 Pleckstrin-like

IPR002219 989 1042 SM00109 Protein kinase C

ProfileScan IPR004012 43 185 PS50826 RUN

IPR001849 536 627 PS50003 Pleckstrin-like

IPR002219 988 1042 PS50081 Protein kinase C

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004012	51	185	PF02759	RUN
IPR001849	537	627	PF00169	Pleckstrin-like
HMMSmart	IPR004012	120	183	SM00593	RUN
IPR001849	537	629	SM00233	Pleckstrin-like
IPR001849	686	781	SM00233	Pleckstrin-like
IPR002219	989	1042	SM00109	Protein kinase C
ProfileScan	IPR004012	43	185	PS50826	RUN
IPR001849	536	627	PS50003	Pleckstrin-like
IPR002219	988	1042	PS50081	Protein kinase C

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ATTCAAAACTCACACGGCAGC

Primer_r
: TGCATTGACTCTTCCCGCCTC

PCR conditions
: 95 °C30 sec64 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 17

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATTCAAAACTCACACGGCAGC
Primer_r	: TGCATTGACTCTTCCCGCCTC
PCR product length	: 159 bp
PCR conditions	: 95 °C15 sec64 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0356

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information