HUGE

Gene/Protein Characteristic Table for KIAA0367

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04274
Accession No. :	AB002365
Description :	BNIP2 motif-containing molecule at the C-terminal region 1.
HUGO Gene Name :
Clone Name :	hh00141s1 [Vector Info]
Source :	Human adult brain
Note :	We replaced hh00141, former representative clones for KIAA0367 with hh00141s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 5656 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 3193 bp

Genome contig ID gi89161216r_78316113
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
TCACTGTATAATTCAGAAATAAAAATTGATTCTGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATGTGATGGTTTTCTTTCTTTGAGTCAGCAAGAATTTTTCTCTGGCTTCA

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 9 r 78416113 78510217 12 99.6 Perfect prediction

Features of the protein sequence	Description

Length: 820 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA20822	100.0	kIAA0367 [Homo ...	Homo sapiens
BAD93351	99.9	BNIP2 motif con...	Homo sapiens
Q58A63	99.4	BNIP2 motif-con...	Homo sapiens
CAQ68519	98.8	prune homolog 2...	Homo sapiens
CAI39749	98.8	prune homolog 2...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB058775	7.2e-40	61.6	KIAA1872

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMSmart IPR001251 630 785 SM00516 Cellular retinaldehyde-binding/triple function

ProfileScan IPR001251 627 788 PS50191 Cellular retinaldehyde-binding/triple function

Search method	interpro_ID	From	To	Entry	Definition
HMMSmart	IPR001251	630	785	SM00516	Cellular retinaldehyde-binding/triple function
ProfileScan	IPR001251	627	788	PS50191	Cellular retinaldehyde-binding/triple function

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AAGGGAACAAACTACTGAGGC

Primer_r
: ATGTTCTATGGGGTTACTCTC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGGGAACAAACTACTGAGGC
Primer_r	: ATGTTCTATGGGGTTACTCTC
PCR product length	: 153 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	3193 bp
Genome contig ID	gi89161216r_78316113
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- TCACTGTATAATTCAGAAATAAAAATTGATTCTGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATGTGATGGTTTTCTTTCTTTGAGTCAGCAAGAATTTTTCTCTGGCTTCA

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	9	r	78416113	78510217	12	99.6	Perfect prediction

Gene/Protein Characteristic Table for KIAA0367

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information