HUGE |
Gene/Protein Characteristic Table for KIAA0367 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04274 |
---|---|
Accession No. : | AB002365 |
Description : | BNIP2 motif-containing molecule at the C-terminal region 1. |
HUGO Gene Name : | |
Clone Name : | hh00141s1 [Vector Info] |
Source : | Human adult brain |
Note : | We replaced hh00141, former representative clones for KIAA0367 with hh00141s1. (2002/5/10) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5656 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3193 bp Genome contig ID gi89161216r_78316113 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
TCACTGTATAATTCAGAAATAAAAATTGATTCTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ATGTGATGGTTTTCTTTCTTTGAGTCAGCAAGAATTTTTCTCTGGCTTCA
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 r 78416113 78510217 12 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 820 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: AAGGGAACAAACTACTGAGGC | |
: ATGTTCTATGGGGTTACTCTC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: AAGGGAACAAACTACTGAGGC | |
: ATGTTCTATGGGGTTACTCTC | |
: 153 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |