HUGE

Gene/Protein Characteristic Table for KIAA0368

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK04854
Accession No. :	AB002366
Description :	Proteasome-associated protein ECM29 homolog.
HUGO Gene Name :
Clone Name :	hh00150 [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5665 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1441 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q5VYK3	100.0	Proteasome-asso...	Homo sapiens
EAW59072	99.9	hCG28762 [Homo ...	Homo sapiens
CAH90910	99.3	hypothetical pr...	Pongo abelii
Q5R6J0	99.1	Proteasome-asso...	Pongo abelii
Q6PDI5	95.3	Proteasome-asso...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000357 532 569 PF02985 HEAT

IPR000357 753 789 PF02985 HEAT

IPR000357 844 881 PF02985 HEAT

IPR000357 991 1027 PF02985 HEAT

IPR000357 1118 1154 PF02985 HEAT

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000357	532	569	PF02985	HEAT
IPR000357	753	789	PF02985	HEAT
IPR000357	844	881	PF02985	HEAT
IPR000357	991	1027	PF02985	HEAT
IPR000357	1118	1154	PF02985	HEAT

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: GAGATTCCTGGTGTTAACGTC

Primer_r
: CTGAAAGTGTAGGGTAAGAGG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 9

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: GAGATTCCTGGTGTTAACGTC
Primer_r	: CTGAAAGTGTAGGGTAAGAGG
PCR product length	: 145 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Gene/Protein Characteristic Table for KIAA0368

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information