HUGE |
Gene/Protein Characteristic Table for KIAA0375 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK00519 |
---|---|
Accession No. : | AB002373 |
Description : | RUN and SH3 domain-containing protein 2. |
HUGO Gene Name : | RUN and SH3 domain containing 2 (RUSC2) |
Clone Name : | hh00360s1 [Vector Info] |
Flexi ORF Clone : | pF1KSDA0375 |
Source : | Human adult brain |
Note : | We replaced hh00360, former representative clones for KIAA0375 with hh00360s1. (2002/12/27) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5216 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 510 bp Genome contig ID gi89161216f_35380124 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
ATTATACCTATTAATAAAAAAGGTGCTCAGCCTCCFlanking genome sequence
(171767 - 171816) ----+----*----+----*----+----*----+----*----+----*
AAACCATTTTCTCTTTGTGTTCCCCCACCCTCCCACCCTCCCACCCACCT
Chr f/r start end exon identity class ContigView(URL based/DAS) 9 f 35480120 35551889 12 99.6 Terminal No-hit
Features of the protein sequence |
Description | |
---|---|---|
Length: 1540 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: CCTCCTCCCTCTTCTGATGAC | |
: AAAGCCATCTACAGGGTTCCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 9 |
: GeneBridge 4 | |
: CCTCCTCCCTCTTCTGATGAC | |
: AAAGCCATCTACAGGGTTCCC | |
: 129 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |