HUGE

Gene/Protein Characteristic Table for KIAA0386

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01079
Accession No. :	AB002384
Description :	Protein FAM65B.
HUGO Gene Name :	family with sequence similarity 65, member B (FAM65B)
Clone Name :	hj00015 [Vector Info]
Flexi ORF Clone :	pF1KA0386
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5471 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2087 bp

Genome contig ID gi89161210r_24812492
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TAAGTTAAAATAAAAATTATTTTTGAATTACTAGC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATCATGTGCAGTCTGATGTTATTTTTTTTCACATGCCCTTTCTGAGTTGG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 r 24912492 25019174 23 99.5 Perfect prediction

Features of the protein sequence	Description

Length: 1085 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW55468	99.8	chromosome 6 op...	Homo sapiens
BAG11177	100.0	FAM65B protein ...	synthetic construct
EAW55470	99.8	chromosome 6 op...	Homo sapiens
XP_001105528	97.7	similar to C27H...	Macaca mulatta
Q9Y4F9	99.7	Protein FAM65B.	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB067517	5.2e-19	28.8	KIAA1930

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: AACTAAAAGCACCCCTCAACC

Primer_r
: CTGTAGTTAGGAGGTATAGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AACTAAAAGCACCCCTCAACC
Primer_r	: CTGTAGTTAGGAGGTATAGCC
PCR product length	: 204 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2087 bp
Genome contig ID	gi89161210r_24812492
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TAAGTTAAAATAAAAATTATTTTTGAATTACTAGC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATCATGTGCAGTCTGATGTTATTTTTTTTCACATGCCCTTTCTGAGTTGG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	r	24912492	25019174	23	99.5	Perfect prediction

Gene/Protein Characteristic Table for KIAA0386

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information