HUGE |
Gene/Protein Characteristic Table for KIAA1930 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK04978 |
---|---|
Accession No. : | AB067517 |
Description : | Protein FAM65A. |
HUGO Gene Name : | |
Clone Name : | fj11193 [Vector Info] |
Source : | Human fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3960 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 321 bp Genome contig ID gi51511732f_66029868 PolyA signal sequence
(AATAAA,-24) +----*----+----*----+----*----+----
GTTTTACAGAAAATAAAAAAGCAAAATGTCTTTCCFlanking genome sequence
(108322 - 108371) ----+----*----+----*----+----*----+----*----+----*
TACATGGCCTGGTACACTCCTGACCCTCTGCTCCAACACCCTCTGGCTGT
Chr f/r start end exon identity class ContigView(URL based/DAS) 16 f 66129868 66138188 21 99.6 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 664 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Motif_DB | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
None | - | - | - | - | - |
Method | No. | N terminal | transmembrane region | C terminal | type | length |
---|---|---|---|---|---|---|
- | - | - | - | - | - | - |
Expression profile |
Description | |
---|---|---|
RT-PCR-ELISA | Description |
---|
Experimental conditions
: CAGCTCACAGTCTTCCAGTTC | |
: AGCACAACAGCCTGATCATCC | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 16 |
: genbank | |
: - | |
: - | |
: - | |
: - |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage ![]() | |