HUGE

Gene/Protein Characteristic Table for KIAA0387

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00525
Accession No. :	AB002385
Description :	Receptor-type tyrosine-protein phosphatase N2 precursor.
HUGO Gene Name :	protein tyrosine phosphatase, receptor type, N polypeptide 2 (PTPRN2)
Clone Name :	hj00020s1 [Vector Info]
Flexi ORF Clone :	pF1KSDA0387
Source :	Human adult brain
Note :	We replaced hj00020, former representative clones for KIAA0387 with hj00020s1. (2002/5/10)

Features of the cloned DNA sequence	Description

Length: 4944 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1657 bp

Genome contig ID gi89161213r_156924512
PolyA signal sequence
(ATTAAA,-19)
+----*----+----*----+----*----+----
TATTTAATTGTGTCATATTAAACTTCTGATTTCAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTCAGGTGGTCTTTATTTGGGGAGGAGGAACAATTGTTTCCATCCGTCT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 r 157024512 158027229 22 99.4 Internal No-hit

Features of the protein sequence	Description

Length: 1042 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAG09726	100.0	protein tyrosin...	synthetic construct
AAC50742	99.9	phogrin [Homo s...	Homo sapiens
Q92932	99.8	Receptor-type t...	Homo sapiens
CAA69880	99.5	Islet Cell Auto...	Homo sapiens
NP_570857	99.8	protein tyrosin...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB006621	4.6e-20	32.0	KIAA0283
AB040904	3.5e-07	23.8	KIAA1471

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000242 826 833 PR00700 Protein-tyrosine phosphatase

IPR000242 843 863 PR00700 Protein-tyrosine phosphatase

IPR000242 928 945 PR00700 Protein-tyrosine phosphatase

IPR000242 967 985 PR00700 Protein-tyrosine phosphatase

IPR000242 999 1014 PR00700 Protein-tyrosine phosphatase

IPR000242 1015 1025 PR00700 Protein-tyrosine phosphatase

HMMPfam IPR000242 797 1031 PF00102 Protein-tyrosine phosphatase

HMMSmart IPR000242 771 1034 SM00194 Protein-tyrosine phosphatase

IPR003595 929 1031 SM00404 Protein-tyrosine phosphatase

ProfileScan IPR000242 772 1032 PS50055 Protein-tyrosine phosphatase

IPR000387 951 1023 PS50056 Protein-tyrosine phosphatase

ScanRegExp IPR000387 970 982 PS00383 Protein-tyrosine phosphatase

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000242	826	833	PR00700	Protein-tyrosine phosphatase
IPR000242	843	863	PR00700	Protein-tyrosine phosphatase
IPR000242	928	945	PR00700	Protein-tyrosine phosphatase
IPR000242	967	985	PR00700	Protein-tyrosine phosphatase
IPR000242	999	1014	PR00700	Protein-tyrosine phosphatase
IPR000242	1015	1025	PR00700	Protein-tyrosine phosphatase
HMMPfam	IPR000242	797	1031	PF00102	Protein-tyrosine phosphatase
HMMSmart	IPR000242	771	1034	SM00194	Protein-tyrosine phosphatase
IPR003595	929	1031	SM00404	Protein-tyrosine phosphatase
ProfileScan	IPR000242	772	1032	PS50055	Protein-tyrosine phosphatase
IPR000387	951	1023	PS50056	Protein-tyrosine phosphatase
ScanRegExp	IPR000387	970	982	PS00383	Protein-tyrosine phosphatase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

SOSUI2 1 643 IALTLVSLACILGVLLASGLIYC 665 PRIMARY 23

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	643	IALTLVSLACILGVLLASGLIYC	665	PRIMARY	23

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CTAAGATGGAGGAATGCTGTG

Primer_r
: CATTTGAGTATCCGATTCGCC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: CTAAGATGGAGGAATGCTGTG
Primer_r	: CATTTGAGTATCCGATTCGCC
PCR product length	: 184 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	1657 bp
Genome contig ID	gi89161213r_156924512
PolyA signal sequence (ATTAAA,-19)	+--------+--------+----*----+---- TATTTAATTGTGTCATATTAAACTTCTGATTTCAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTCAGGTGGTCTTTATTTGGGGAGGAGGAACAATTGTTTCCATCCGTCT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	r	157024512	158027229	22	99.4	Internal No-hit

Gene/Protein Characteristic Table for KIAA0387

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information