HUGE

Gene/Protein Characteristic Table for KIAA0391

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01081
Accession No. :	AB002389
Description :
HUGO Gene Name :
Clone Name :	hj00118 [Vector Info]
Flexi ORF Clone :	pF1KA0391
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5677 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3614 bp

Genome contig ID gi51511730f_34561528
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
ACACAGATGAATAAATGTAATAAAATTTGAGAAAT
Flanking genome sequence
(255045 - 255094)
----+----*----+----*----+----*----+----*----+----*
AATCTTTACTTTTATCATCTCCATTTATGCTTTTTCATGATGTCCTGACG

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 14 f 34661528 34816571 8 99.3 Perfect prediction

Features of the protein sequence	Description

Length: 571 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAG64973	0	99.8	unnamed protein...	Homo sapiens
XP_001084913	1.9e-201	90.3	hypothetical pr...	Macaca mulatta
XP_001084800	6.5e-124	86.8	similar to CG15...	Macaca mulatta
Q4R366	1.4e-123	86.8	Mitochondrial r...	Macaca fascicularis
BAG63351	1.6e-102	96.5	unnamed protein...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

Motif_DB interpro_ID From To Entry Definition

None - - - - -

Motif_DB	interpro_ID	From	To	Entry	Definition
None	-	-	-	-	-

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: ATTTCTATGGCTTCCCCTCTG

Primer_r
: TGAGCAGAAAGGAAATAGGAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 14

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: ATTTCTATGGCTTCCCCTCTG
Primer_r	: TGAGCAGAAAGGAAATAGGAC
PCR product length	: 131 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3614 bp
Genome contig ID	gi51511730f_34561528
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- ACACAGATGAATAAATGTAATAAAATTTGAGAAAT
Flanking genome sequence (255045 - 255094)	----+--------+--------+--------+--------+----* AATCTTTACTTTTATCATCTCCATTTATGCTTTTTCATGATGTCCTGACG

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	14	f	34661528	34816571	8	99.3	Perfect prediction

Gene/Protein Characteristic Table for KIAA0391

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information