HUGE |
Gene/Protein Characteristic Table for KIAA0399 |
Link to :
Rouge |
GTOP | SWISS-PROT/TrEMBL | GeneCards| RefDIC | |
Features : DNA sequence | Protein sequence | Expression | Mapping | |
Product ID : | ORK01083 |
---|---|
Accession No. : | AB007859 |
Description : | Zinc finger ZZ-type and EF-hand domain-containing protein 1. |
HUGO Gene Name : | zinc finger, ZZ-type with EF-hand domain 1 (ZZEF1) |
Clone Name : | hg00651s2 [Vector Info] |
Flexi ORF Clone : | pF1KA0399 |
Source : | Human adult brain |
Note : | We replaced hg00651 and hg00651s1, former representative clones for KIAA0399 with hg00651s2. (2002/5/10,2005/08/06) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 11394 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2444 bp Genome contig ID gi51511734r_3754489 PolyA signal sequence
(AATATA,-31) +----*----+----*----+----*----+----
AAGAAATATATTGTACAAATTCTATATAATAAGGTFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
ACGCCTGTGTGTGGACTGGTCTCTCCCTCCTCCCTCCGCCCCGCCGTGTC
Chr f/r start end exon identity class ContigView(URL based/DAS) 17 r 3854489 3993002 55 99.7 Perfect prediction
Features of the protein sequence |
Description | |
---|---|---|
Length: 2982 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Expression profile |
Description | |
---|---|---|
RT-PCR | Description |
---|
: GAAAATACGTCACTCCTCTCG | |
: AAGTCCCGCAGAGCAAAGGTG | |
: 95 °C |
RH mapping information |
Description | |
---|---|---|
: 17 |
: GeneBridge 4 | |
: GAAAATACGTCACTCCTCTCG | |
: AAGTCCCGCAGAGCAAAGGTG | |
: 115 bp | |
: 95 °C |
How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage | |