HUGE

Gene/Protein Characteristic Table for KIAA0708

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :
Accession No. :	AB014608
Description :	p53-associated parkin-like cytoplasmic protein.
HUGO Gene Name :
Clone Name :	hh01062b [Vector Info]
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 5403 bp
Physical map
Restriction map
The cloned DNA sequence was revised by direct RT-PCR/sequencing experiments following the alert of coding interruption by GeneMark analysis.
Comparison between the cloned and the revised DNA sequences.
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq. revised DNA seq.
Warning for N-terminal truncation:
YES YES

Warning for coding interruption:
YES NO

Integrity of 3' end

Length of 3'UTR 141 bp

Genome contig ID gi89161210f_43168828
PolyA signal sequence
(AATAAA,-24)
+----*----+----*----+----*----+----
CCTGTTTGCTGAATAAAGGTCTCTTTCTCACACAC
Flanking genome sequence
(131476 - 131525)
----+----*----+----*----+----*----+----*----+----*
ATCTCTGGGAGCAGGCTGACAGCTTCACCAGGGGCCAGCCAAGTTGCCAC

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 6 f 43268828 43300302 33 100.0 Perfect prediction

Features of the protein sequence	Description

Length: 1753 aa
This protein sequence is predicted from the revised DNA sequence

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAN61516	100.0	p53-associated ...	Homo sapiens
Q8IWT3	100.0	p53-associated ...	Homo sapiens
CAI20204	99.9	novel protein [...	Homo sapiens
CAH18328	99.8	hypothetical pr...	Homo sapiens
XP_518908	99.3	p53-associated ...	Pan troglodytes

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D38548	6.6e-133	62.2	KIAA0076
D79983	4.1e-08	26.9	KIAA0161
AB007859	2.1e-07	40.9	KIAA0399
AB037807	2.1e-06	25.3	KIAA1386

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR004939 376 552 PF03256 Anaphase-promoting complex subunit 10

IPR001373 608 1075 PF00888 Cullin

IPR002867 1376 1439 PF01485 Zinc finger

HMMSmart IPR002867 1376 1439 SM00647 Zinc finger

IPR002867 1460 1515 SM00647 Zinc finger

ProfileScan IPR001373 780 1048 PS50069 Cullin

IPR001841 1472 1515 PS50089 Zinc finger

ScanRegExp IPR001128 473 482 PS00086 Cytochrome P450

IPR001373 1162 1189 PS01256 Cullin

IPR001841 1493 1502 PS00518 Zinc finger

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR004939	376	552	PF03256	Anaphase-promoting complex subunit 10
IPR001373	608	1075	PF00888	Cullin
IPR002867	1376	1439	PF01485	Zinc finger
HMMSmart	IPR002867	1376	1439	SM00647	Zinc finger
IPR002867	1460	1515	SM00647	Zinc finger
ProfileScan	IPR001373	780	1048	PS50069	Cullin
IPR001841	1472	1515	PS50089	Zinc finger
ScanRegExp	IPR001128	473	482	PS00086	Cytochrome P450
IPR001373	1162	1189	PS01256	Cullin
IPR001841	1493	1502	PS00518	Zinc finger

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description
: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: AAGATGAGGCCTATGACTGAG

Primer_r
: AGCAAACAGGAAGCACTACAG

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 6

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: AAGATGAGGCCTATGACTGAG
Primer_r	: AGCAAACAGGAAGCACTACAG
PCR product length	: 136 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.	revised DNA seq.
Warning for N-terminal truncation:	YES	YES
Warning for coding interruption:	YES	NO

Length of 3'UTR	141 bp
Genome contig ID	gi89161210f_43168828
PolyA signal sequence (AATAAA,-24)	+--------+--------+----*----+---- CCTGTTTGCTGAATAAAGGTCTCTTTCTCACACAC
Flanking genome sequence (131476 - 131525)	----+--------+--------+--------+--------+----* ATCTCTGGGAGCAGGCTGACAGCTTCACCAGGGGCCAGCCAAGTTGCCAC

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	6	f	43268828	43300302	33	100.0	Perfect prediction

Gene/Protein Characteristic Table for KIAA0708

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information