HUGE

Gene/Protein Characteristic Table for KIAA1386

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK01163
Accession No. :	AB037807
Description :	Ankyrin repeat and IBR domain-containing protein 1 (Fragment).
HUGO Gene Name :	ankyrin repeat and IBR domain containing 1 (ANKIB1)
Clone Name :	fj06274 [Vector Info]
Flexi ORF Clone :	pF1KA1386
Source :	Human fetal brain

Features of the cloned DNA sequence	Description

Length: 4030 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 384 bp

Genome contig ID gi89161213f_91613484
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AGGCTTACTCCCTAATCTTTGGGTGGCTTTCCTTT
Flanking genome sequence
(253101 - 253150)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAGTTTTCTTCATTCTAGAAATTTATTTTGGATAAAT

Ensembl ContigView (Add our DAS server as a DAS source)

Chr f/r start end exon identity class

ContigView(URL based/DAS) 7 f 91713484 91866583 20 99.7 Perfect prediction

Features of the protein sequence	Description

Length: 1214 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_519196	99.7	ankyrin repeat ...	Pan troglodytes
AAH63861	99.9	ANKIB1 protein ...	Homo sapiens
BAG11319	100.0	ankyrin repeat ...	synthetic construct
Q9P2G1	99.9	Ankyrin repeat ...	Homo sapiens
XP_850019	96.4	similar to Anky...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB014608	1.6e-06	26.0	KIAA0708

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002110 171 183 PR01415 Ankyrin

IPR002110 282 294 PR01415 Ankyrin

HMMPfam IPR002110 170 202 PF00023 Ankyrin

IPR002110 269 301 PF00023 Ankyrin

IPR002867 527 603 PF01485 Zinc finger

IPR002867 643 677 PF01485 Zinc finger

IPR003903 975 992 PF02809 Ubiquitin interacting motif

HMMSmart IPR002110 170 199 SM00248 Ankyrin

IPR002110 269 298 SM00248 Ankyrin

IPR001841 458 506 SM00184 Zinc finger

IPR002867 527 603 SM00647 Zinc finger

IPR002867 626 690 SM00647 Zinc finger

IPR001841 644 768 SM00184 Zinc finger

ProfileScan IPR002110 170 202 PS50088 Ankyrin

IPR002110 170 322 PS50297 Ankyrin

IPR002110 269 301 PS50088 Ankyrin

IPR001841 458 504 PS50089 Zinc finger

IPR003903 976 995 PS50330 Ubiquitin interacting motif

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002110	171	183	PR01415	Ankyrin
IPR002110	282	294	PR01415	Ankyrin
HMMPfam	IPR002110	170	202	PF00023	Ankyrin
IPR002110	269	301	PF00023	Ankyrin
IPR002867	527	603	PF01485	Zinc finger
IPR002867	643	677	PF01485	Zinc finger
IPR003903	975	992	PF02809	Ubiquitin interacting motif
HMMSmart	IPR002110	170	199	SM00248	Ankyrin
IPR002110	269	298	SM00248	Ankyrin
IPR001841	458	506	SM00184	Zinc finger
IPR002867	527	603	SM00647	Zinc finger
IPR002867	626	690	SM00647	Zinc finger
IPR001841	644	768	SM00184	Zinc finger
ProfileScan	IPR002110	170	202	PS50088	Ankyrin
IPR002110	170	322	PS50297	Ankyrin
IPR002110	269	301	PS50088	Ankyrin
IPR001841	458	504	PS50089	Zinc finger
IPR003903	976	995	PS50330	Ubiquitin interacting motif

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR-ELISA Description
: Experimental conditions

Primer_f
: ACAGAGGAGATGGTTCAGATG

Primer_r
: ATCAAGCATACTCCACCTAGC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR-ELISA	Description

RH mapping information	Description

Chromosome No.

: 7

Experimental conditions

Panel name	: unigene
Primer_f	: -
Primer_r	: -
PCR product length	: -
PCR conditions	: -

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	384 bp
Genome contig ID	gi89161213f_91613484
PolyA signal sequence (None)	+--------+--------+----*----+---- AGGCTTACTCCCTAATCTTTGGGTGGCTTTCCTTT
Flanking genome sequence (253101 - 253150)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAGTTTTCTTCATTCTAGAAATTTATTTTGGATAAAT

	Chr	f/r	start	end	exon	identity	class
ContigView(URL based/DAS)	7	f	91713484	91866583	20	99.7	Perfect prediction

Primer_f	: ACAGAGGAGATGGTTCAGATG
Primer_r	: ATCAAGCATACTCCACCTAGC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA1386

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information