HUGE

Gene/Protein Characteristic Table for KIAA0404

Link to : Rouge \| GTOP \| SWISS-PROT/TrEMBL \| GeneCards\| RefDIC
Features : DNA sequence \| Protein sequence \| Expression \| Mapping

Product ID :	ORK00066
Accession No. :	AB007864
Description :	ATG2 autophagy related 2 homolog A.
HUGO Gene Name :	ATG2 autophagy related 2 homolog A (S. cerevisiae) (ATG2A)
Clone Name :	hg01236 [Vector Info]
Flexi ORF Clone :	pF1KA0404
Source :	Human adult brain

Features of the cloned DNA sequence	Description

Length: 6299 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Features of the protein sequence	Description

Length: 1956 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q2TAZ0	100.0	Autophagy-relat...	Homo sapiens
AAI10651	99.9	ATG2 autophagy ...	Homo sapiens
XP_001114733	97.7	similar to Auto...	Macaca mulatta
ACA64880	96.0	ATG2 autophagy ...	Callicebus moloch
XP_608267	87.3	similar to Auto...	Bos taurus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other HUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR015412 1853 1950 PF09333 ATG2

ScanRegExp IPR006093 1289 1322 PS00862 Oxygen oxidoreductase covalent FAD-binding site

IPR002328 1894 1908 PS00059 Alcohol dehydrogenase

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR015412	1853	1950	PF09333	ATG2
ScanRegExp	IPR006093	1289	1322	PS00862	Oxygen oxidoreductase covalent FAD-binding site
IPR002328	1894	1908	PS00059	Alcohol dehydrogenase

Prediction of transmembrane (TM) segments

Method No. N terminal transmembrane region C terminal type length

- - - - - - -

Method	No.	N terminal	transmembrane region	C terminal	type	length
-	-	-	-	-	-	-

Expression profile	Description

: RT-PCR Description

Experimental conditions

Primer_f
: CCTGGCTCTGCACTTTTCCTC

Primer_r
: CCCCCAGACACAGAAAGACAC

PCR conditions
: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

RT-PCR	Description

RH mapping information	Description

Chromosome No.

: 11

Experimental conditions

Panel name	: GeneBridge 4
Primer_f	: TATTCCACTTCATGCAGACAC
Primer_r	: AGTGTCTTTCTGTGTCTGGGG
PCR product length	: 107 bp
PCR conditions	: 95 °C15 sec62 °C60 sec30 cycles

How to obtain KIAA clone(s) Back to the HUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Primer_f	: CCTGGCTCTGCACTTTTCCTC
Primer_r	: CCCCCAGACACAGAAAGACAC
PCR conditions	: 95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Gene/Protein Characteristic Table for KIAA0404

Features of the cloned DNA sequence

Features of the protein sequence

Expression profile

RH mapping information